ClinVar Genomic variation as it relates to human health
NM_000421.5(KRT10):c.1654AGCTCCGGCGGCGGATACGGCGGCGGCAGC[3] (p.556GYGGGSSSGG[3])
Germline
Classification
(3)
Uncertain significance
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation Viewer | Related variants | ||
---|---|---|---|---|---|---|
HI score | TS score | Within gene | All | |||
KRT10 | - | - |
GRCh38 GRCh37 |
95 | 208 |
Conditions - Germline
Condition | Classification
(# of submissions) |
Review status | Last evaluated | Variation/condition record |
---|---|---|---|---|
Uncertain significance (2) |
|
Jan 7, 2022 | RCV001355196.6 | |
Uncertain significance (1) |
|
Jan 28, 2022 | RCV002476626.2 |
Citations for germline classification of this variant
HelpText-mined citations for rs776920005 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Sep 29, 2024