U.S. flag

An official website of the United States government

NM_004387.4(NKX2-5):c.117_164dup (p.Ala55_Tyr56insThrLeuAlaProSerSerCysMetLeuAlaAlaPheLysProGluAla) AND Cardiovascular phenotype

Germline classification:
Uncertain significance (1 submission)
Last evaluated:
Jul 28, 2023
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV003358387.2

Allele description [Variation Report for NM_004387.4(NKX2-5):c.117_164dup (p.Ala55_Tyr56insThrLeuAlaProSerSerCysMetLeuAlaAlaPheLysProGluAla)]

NM_004387.4(NKX2-5):c.117_164dup (p.Ala55_Tyr56insThrLeuAlaProSerSerCysMetLeuAlaAlaPheLysProGluAla)

Gene:
NKX2-5:NK2 homeobox 5 [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
5q35.1
Genomic location:
Preferred name:
NM_004387.4(NKX2-5):c.117_164dup (p.Ala55_Tyr56insThrLeuAlaProSerSerCysMetLeuAlaAlaPheLysProGluAla)
HGVS:
  • NC_000005.10:g.173234925_173234972dup
  • NG_013340.1:g.5346_5393dup
  • NM_001166175.2:c.117_164dup
  • NM_001166176.2:c.117_164dup
  • NM_004387.4:c.117_164dupMANE SELECT
  • NP_001159647.1:p.Ala55_Tyr56insThrLeuAlaProSerSerCysMetLeuAlaAlaPheLysProGluAla
  • NP_001159648.1:p.Ala55_Tyr56insThrLeuAlaProSerSerCysMetLeuAlaAlaPheLysProGluAla
  • NP_004378.1:p.Ala55_Tyr56insThrLeuAlaProSerSerCysMetLeuAlaAlaPheLysProGluAla
  • LRG_671t1:c.117_164dup
  • LRG_671:g.5346_5393dup
  • LRG_671p1:p.Ala55_Tyr56insThrLeuAlaProSerSerCysMetLeuAlaAlaPheLysProGluAla
  • NC_000005.9:g.172661928_172661975dup
  • NM_004387.3:c.117_164dupGACCCTGGCGCCCTCCTCCTGCATGCTGGCCGCCTTCAAGCCAGAGGC
Molecular consequence:
  • NM_001166175.2:c.117_164dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001166176.2:c.117_164dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_004387.4:c.117_164dup - inframe_insertion - [Sequence Ontology: SO:0001821]

Condition(s)

Name:
Cardiovascular phenotype
Identifiers:
MedGen: CN230736

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV004055664Ambry Genetics
criteria provided, single submitter

(Ambry Variant Classification Scheme 2023)
Uncertain significance
(Jul 28, 2023)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From Ambry Genetics, SCV004055664.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

The c.117_164dup48 variant (also known as p.T40_A55dup), located in coding exon 1 of the NKX2-5 gene, results from an in-frame duplication of 48 nucleotides at nucleotide positions 117 to 164. This results in the duplication of 16 extra residues (TLAPSSCMLAAFKPEA) between codons 40 and 55. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: May 1, 2024