U.S. flag

An official website of the United States government

NM_003924.4(PHOX2B):c.756_776dup (p.Ala254_Ala260dup) AND Congenital central hypoventilation

Germline classification:
Pathogenic (1 submission)
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV003335452.1

Allele description [Variation Report for NM_003924.4(PHOX2B):c.756_776dup (p.Ala254_Ala260dup)]

NM_003924.4(PHOX2B):c.756_776dup (p.Ala254_Ala260dup)

Genes:
PHOX2B:paired like homeobox 2B [Gene - OMIM - HGNC]
LOC110011216:paired like homeobox 2b polyalanine repeat instability region [Gene]
Variant type:
Duplication
Cytogenetic location:
4p13
Genomic location:
Preferred name:
NM_003924.4(PHOX2B):c.756_776dup (p.Ala254_Ala260dup)
HGVS:
  • NC_000004.12:g.41745990_41746010dup
  • NG_008243.1:g.7975_7995dup
  • NG_053075.1:g.116_136dup
  • NM_003924.4:c.756_776dupMANE SELECT
  • NP_003915.2:p.Ala254_Ala260dup
  • NP_003915.2:p.Ala254_Ala260dup
  • LRG_513t1:c.756_776dup
  • LRG_513:g.7975_7995dup
  • LRG_513p1:p.Ala254_Ala260dup
  • NC_000004.11:g.41748007_41748027dup
  • NM_003924.3:c.756_776dup
  • NM_003924.3:c.756_776dupGGCGGCAGCGGCAGCGGCGGC
Links:
dbSNP: rs17879189
NCBI 1000 Genomes Browser:
rs17879189
Molecular consequence:
  • NM_003924.4:c.756_776dup - inframe_insertion - [Sequence Ontology: SO:0001821]

Condition(s)

Name:
Congenital central hypoventilation
Synonyms:
Idiopathic congenital central alveolar hypoventilation; Congenital failure of autonomic control; Primary alveolar hypoventilation; See all synonyms [MedGen]
Identifiers:
MONDO: MONDO:0800031; MedGen: C1275808; Orphanet: 661; Orphanet: 99803; OMIM: PS209880

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV004046366Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego
criteria provided, single submitter

(ACMG Guidelines, 2015)
Pathogenicgermlineclinical testing

PubMed (1)
[See all records that cite this PMID]

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.

Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality Assurance Committee..

Genet Med. 2015 May;17(5):405-24. doi: 10.1038/gim.2015.30. Epub 2015 Mar 5.

PubMed [citation]
PMID:
25741868
PMCID:
PMC4544753

Details of each submission

From Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego, SCV004046366.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (1)

Description

This variant is located within the polyalanine tract in exon 3 of the PHOX2B gene and causes an in-frame duplication resulting in an expansion event. An alternative nomenclature for this variant is p.Ala241[27], which corresponds to a 27 polyalanine repeat expansion (PMID: 20301600). Repeat expansions within the polyalanine tract in the PHOX2B gene are an established mechanism of disease and have been previously reported in patients with Congenital Central Hypoventilation Syndrome (PMID: 12640453, 14566559, 14608649, 15121777). This variant has been previously reported as a heterozygous change in multiple individuals with Congenital Central Hypoventilation Syndrome (PMID: 20456320). It is absent from the gnomAD population database and thus is presumed to be rare. Analysis of the parental samples was negative for the variant, indicating that this variant likely occurred as a de novo event. Based on the available evidence, the c.756_776dup (p.Ala254_Ala260dup) variant is classified as Pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Oct 13, 2024