NM_000474.4(TWIST1):c.397_417dup (p.Lys133_Pro139dup) AND TWIST1-related craniosynostosis

Germline classification:: Pathogenic (2 submissions)
Last evaluated:: Mar 10, 2023
Review status:: 1 star out of maximum of 4 stars
criteria provided, single submitter

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV003229593.9

Allele description [Variation Report for NM_000474.4(TWIST1):c.397_417dup (p.Lys133_Pro139dup)]

NM_000474.4(TWIST1):c.397_417dup (p.Lys133_Pro139dup)

Gene:

TWIST1:twist family bHLH transcription factor 1 [Gene - OMIM - HGNC]

Variant type:

Duplication

Cytogenetic location:

7p21.1

Genomic location:

Preferred name:

NM_000474.4(TWIST1):c.397_417dup (p.Lys133_Pro139dup)

HGVS:

NC_000007.14:g.19116905_19116925dup
NG_008114.2:g.5748_5768dup
NM_000474.4:c.397_417dupMANE SELECT
NP_000465.1:p.Lys133_Pro139dup
NC_000007.13:g.19156527_19156528insGGGCAGCGTGGGGATGATCTT
NC_000007.13:g.19156528_19156548dup
NM_000474.3:c.397_417dup
NM_000474.3:c.397_417dupAAGATCATCCCCACGCTGCCC
NR_149001.2:n.712_732dup

Links:

dbSNP: rs1554441989

NCBI 1000 Genomes Browser:

rs1554441989

Molecular consequence:

NM_000474.4:c.397_417dup - inframe_insertion - [Sequence Ontology: SO:0001821]
NR_149001.2:n.712_732dup - non-coding transcript variant - [Sequence Ontology: SO:0001619]

Condition(s)

Name:: TWIST1-related craniosynostosis (CRS1)
Synonyms:: Craniosynostosis 1
Identifiers:: MONDO: MONDO:0007399; MedGen: C4551902; Orphanet: 63440; OMIM: 123100

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV003926476	Clinical Laboratory Sciences Program (CLSP), King Saud bin Abdulaziz University for Health Sciences (KSAU-HS)	no assertion criteria provided	Pathogenic	germline	clinical testing
SCV003927239	Johns Hopkins Genomics, Johns Hopkins University	criteria provided, single submitter (ACMG Guidelines, 2015)	Pathogenic (Mar 10, 2023)	germline	clinical testing	PubMed (6) [See all records that cite these PMIDs] 10749989, 16251895, 16838304, 30074960, 8988167, 25741868

Submission Accession

Submitter

Review Status
(Assertion method)

Clinical Significance
(Last evaluated)

Origin

Method

Citations

SCV003926476

Clinical Laboratory Sciences Program (CLSP), King Saud bin Abdulaziz University for Health Sciences (KSAU-HS)

no assertion criteria provided

Pathogenic

germline

clinical testing

SCV003927239

Johns Hopkins Genomics, Johns Hopkins University

criteria provided, single submitter

(ACMG Guidelines, 2015)

Pathogenic
(Mar 10, 2023)

germline

clinical testing

PubMed (6)
[See all records that cite these PMIDs]

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	yes	not provided	not provided	not provided	not provided	not provided	clinical testing
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

Saethre-Chotzen mutations cause TWIST protein degradation or impaired nuclear location.

El Ghouzzi V, Legeai-Mallet L, Aresta S, Benoist C, Munnich A, de Gunzburg J, Bonaventure J.

Hum Mol Genet. 2000 Mar 22;9(5):813-9.

PubMed [citation]

PMID:: 10749989

Saethre-Chotzen syndrome caused by TWIST 1 gene mutations: functional differentiation from Muenke coronal synostosis syndrome.

Kress W, Schropp C, Lieb G, Petersen B, Büsse-Ratzka M, Kunz J, Reinhart E, Schäfer WD, Sold J, Hoppe F, Pahnke J, Trusen A, Sörensen N, Krauss J, Collmann H.

Eur J Hum Genet. 2006 Jan;14(1):39-48.

PubMed [citation]

PMID:: 16251895

See all PubMed Citations (6)

Details of each submission

From Clinical Laboratory Sciences Program (CLSP), King Saud bin Abdulaziz University for Health Sciences (KSAU-HS), SCV003926476.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	not provided

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	yes	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Johns Hopkins Genomics, Johns Hopkins University, SCV003927239.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (6)

Description

This TWIST1 variant has been reported in multiple unrelated individuals with TWIST1-related disorders, including as a de novo occurrence. This variant is absent from a large population dataset but has been reported in ClinVar (Variation ID 458686). Bioinformatic analysis predicts that this in-frame duplication variant would not affect normal exon 1 splicing7, although this has not been confirmed experimentally to our knowledge. The amino acids involved in the duplication are evolutionarily conserved across most of the species assessed. We consider c.397_417dup; p.Lys133_Pro139dup in TWIST1 to be pathogenic.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Last Updated: Sep 29, 2024

ClinVar

Relating variation to medicine