U.S. flag

An official website of the United States government

NM_004333.6(BRAF):c.1388_1408dup (p.Ile463_Gly469dup) AND not provided

Germline classification:
not provided (1 submission)
Review status:
no classification provided
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001803961.1

Allele description [Variation Report for NM_004333.6(BRAF):c.1388_1408dup (p.Ile463_Gly469dup)]

NM_004333.6(BRAF):c.1388_1408dup (p.Ile463_Gly469dup)

Gene:
BRAF:B-Raf proto-oncogene, serine/threonine kinase [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
7q34
Genomic location:
Preferred name:
NM_004333.6(BRAF):c.1388_1408dup (p.Ile463_Gly469dup)
HGVS:
  • NC_000007.14:g.140781603_140781623dup
  • NG_007873.3:g.148145_148165dup
  • NM_001354609.2:c.1388_1408dup
  • NM_001374244.1:c.1508_1528dup
  • NM_001374258.1:c.1508_1528dup
  • NM_001378467.1:c.1397_1417dup
  • NM_001378468.1:c.1388_1408dup
  • NM_001378469.1:c.1322_1342dup
  • NM_001378470.1:c.1286_1306dup
  • NM_001378471.1:c.1277_1297dup
  • NM_001378472.1:c.1232_1252dup
  • NM_001378473.1:c.1232_1252dup
  • NM_001378474.1:c.1388_1408dup
  • NM_001378475.1:c.1124_1144dup
  • NM_004333.6:c.1388_1408dupMANE SELECT
  • NP_001341538.1:p.Ile463_Gly469dup
  • NP_001361173.1:p.Ile503_Gly509dup
  • NP_001361187.1:p.Ile503_Gly509dup
  • NP_001365396.1:p.Ile466_Gly472dup
  • NP_001365397.1:p.Ile463_Gly469dup
  • NP_001365398.1:p.Ile441_Gly447dup
  • NP_001365399.1:p.Ile429_Gly435dup
  • NP_001365400.1:p.Ile426_Gly432dup
  • NP_001365401.1:p.Ile411_Gly417dup
  • NP_001365402.1:p.Ile411_Gly417dup
  • NP_001365403.1:p.Ile463_Gly469dup
  • NP_001365404.1:p.Ile375_Gly381dup
  • NP_004324.2:p.Ile463_Gly469dup
  • LRG_299:g.148145_148165dup
  • NC_000007.13:g.140481403_140481423dup
  • NM_004333.4:c.1388_1408dupTTGGATCTGGATCATTTGGAA
Links:
dbSNP: rs1562956929
NCBI 1000 Genomes Browser:
rs1562956929
Molecular consequence:
  • NM_001354609.2:c.1388_1408dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001374244.1:c.1508_1528dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001374258.1:c.1508_1528dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378467.1:c.1397_1417dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378468.1:c.1388_1408dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378469.1:c.1322_1342dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378470.1:c.1286_1306dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378471.1:c.1277_1297dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378472.1:c.1232_1252dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378473.1:c.1232_1252dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378474.1:c.1388_1408dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001378475.1:c.1124_1144dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_004333.6:c.1388_1408dup - inframe_insertion - [Sequence Ontology: SO:0001821]

Condition(s)

Synonyms:
none provided
Identifiers:
MedGen: CN517202

Recent activity

Clear Turn Off Turn On
  • Respiratory Sounds
    Respiratory Sounds
    Noises, normal and abnormal, heard on auscultation over any part of the RESPIRATORY TRACT.<br/>Year introduced: 1980
    MeSH

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Help
Submission AccessionSubmitterReview Status
(Assertion method)		Clinical Significance
(Last evaluated)		OriginMethodCitations
SCV002047672GenomeConnect - CFC International
no classification provided
not providedunknownphenotyping only

Help

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedunknownyesnot providednot providednot providednot providednot providedphenotyping only

Details of each submission

From GenomeConnect - CFC International, SCV002047672.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedphenotyping onlynot provided

Description

Variant interpreted as Likely pathogenic and reported on 11-03-2017 by lab or GTR ID Nationwide Children's Hospital. GenomeConnect - CFC International assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1unknownyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Jan 7, 2023