U.S. flag

An official website of the United States government

NM_000314.6(PTEN):c.-903_-882dup AND not specified

Germline classification:
Uncertain significance (1 submission)
Last evaluated:
Sep 30, 2021
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001731501.10

Allele description [Variation Report for NM_000314.6(PTEN):c.-903_-882dup]

NM_000314.6(PTEN):c.-903_-882dup

Genes:
PTEN:phosphatase and tensin homolog [Gene - OMIM - HGNC]
LOC130004273:ATAC-STARR-seq lymphoblastoid silent region 2585 [Gene]
Variant type:
Duplication
Cytogenetic location:
10q23.31
Genomic location:
Preferred name:
NM_000314.6(PTEN):c.-903_-882dup
HGVS:
  • NC_000010.11:g.87863566_87863587dup
  • NG_007466.2:g.5129_5150dup
  • NG_033079.1:g.4854_4875dup
  • NG_183718.1:g.287_308dup
  • NM_000314.4:c.-903_-882dup
  • NM_000314.6:c.-903_-882dup
  • NM_001304717.4:c.-384_-363dup
  • NM_001304718.1:c.-1608_-1587dup
  • LRG_311t1:c.-903_-882dup
  • LRG_1087:g.4854_4875dup
  • LRG_311:g.5129_5150dup
  • NC_000010.10:g.89623323_89623344dup
  • NM_000314.4:c.-903_-882dupGGGACTCTTTATGCGCTGCGGC
  • NM_000314.4:c.-904_-883dup
  • NM_000314.4:c.-904_-883dup
  • NM_000314.6:c.-903_-882dup22
  • NM_000314.6:c.-904_-883dup22
  • NM_000314.6:c.-904_-883dup22
  • c.-904_-883dupGGGACTCTTTATGCGCTGCGGC[hg19]
Links:
dbSNP: rs786204888
NCBI 1000 Genomes Browser:
rs786204888

Condition(s)

Synonyms:
AllHighlyPenetrant
Identifiers:
MedGen: CN169374

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV001983452Women's Health and Genetics/Laboratory Corporation of America, LabCorp
criteria provided, single submitter

(LabCorp Variant Classification Summary - May 2015)
Uncertain significance
(Sep 30, 2021)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From Women's Health and Genetics/Laboratory Corporation of America, LabCorp, SCV001983452.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

Variant summary: PTEN c.-904_-883dup22 (also known as c.-903_-882dup22 in RefSeq) is located in the promoter region upstream of the initiation codon. PTEN mutations causing Cowden syndrome include a noticeable number of variants on the promoter region affecting transcriptional levels of the gene or causing abnormal translation of the protein (PMID 22171747). However, the effect of c.-904_-883dup22 on gene transcription or translation is not clear. This variant was absent in 31202 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.-904_-883dup22 in individuals affected with Cowden Syndrome and no experimental evidence demonstrating its impact on protein function have been reported. One clinical diagnostic laboratory has submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation and classified the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as uncertain significance.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Nov 3, 2024