NM_153717.3(EVC):c.2562-3_2584del AND multiple conditions

Germline classification:: Likely pathogenic (1 submission)
Last evaluated:: Jan 29, 2024
Review status:: 1 star out of maximum of 4 stars
criteria provided, single submitter

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000824617.5

Allele description [Variation Report for NM_153717.3(EVC):c.2562-3_2584del]

NM_153717.3(EVC):c.2562-3_2584del

Gene:

EVC:EvC ciliary complex subunit 1 [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

4p16.2

Genomic location:

Preferred name:

NM_153717.3(EVC):c.2562-3_2584del

HGVS:

NC_000004.12:g.5808198_5808223del
NG_008843.1:g.102002_102027del
NM_001306090.2:c.2562-3_2584del
NM_153717.3:c.2562-3_2584delMANE SELECT
NC_000004.11:g.5809925_5809950del
NC_000004.11:g.5809925_5809950delCAGGATGCTGTCCCAGCAGAAGAGGT
NM_153717.2:c.2562-3_2584del

Links:

dbSNP: rs1577663625

NCBI 1000 Genomes Browser:

rs1577663625

Molecular consequence:

NM_001306090.2:c.2562-3_2584del - splice acceptor variant - [Sequence Ontology: SO:0001574]
NM_153717.3:c.2562-3_2584del - splice acceptor variant - [Sequence Ontology: SO:0001574]

Condition(s)

Name:: Ellis-van Creveld syndrome (EVC)
Synonyms:: Chondroectodermal dysplasia; Mesoectodermal dysplasia
Identifiers:: MONDO: MONDO:0009162; MedGen: C0013903; Orphanet: 289; OMIM: 225500

Name:: Curry-Hall syndrome (WAD)
Synonyms:: Acrofacial dysostosis of Weyers; WEYERS ACRODENTAL DYSOSTOSIS
Identifiers:: MONDO: MONDO:0008673; MedGen: C0457013; Orphanet: 952; OMIM: 193530

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000965522	Invitae	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Likely pathogenic (Jan 29, 2024)	germline	clinical testing	PubMed (3) [See all records that cite these PMIDs] 16199547, 23220543, 28492532

Submission Accession

Submitter

Review Status
(Assertion method)

Clinical Significance
(Last evaluated)

Origin

Method

Citations

SCV000965522

Invitae

criteria provided, single submitter

(Invitae Variant Classification Sherloc (09022015))

Likely pathogenic
(Jan 29, 2024)

germline

clinical testing

PubMed (3)
[See all records that cite these PMIDs]

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

Splicing in action: assessing disease causing sequence changes.

Baralle D, Baralle M.

J Med Genet. 2005 Oct;42(10):737-48. Review.

PubMed [citation]

PMID:: 16199547
PMCID:: PMC1735933

Novel and recurrent EVC and EVC2 mutations in Ellis-van Creveld syndrome and Weyers acrofacial dyostosis.

D'Asdia MC, Torrente I, Consoli F, Ferese R, Magliozzi M, Bernardini L, Guida V, Digilio MC, Marino B, Dallapiccola B, De Luca A.

Eur J Med Genet. 2013 Feb;56(2):80-7. doi: 10.1016/j.ejmg.2012.11.005. Epub 2012 Dec 7.

PubMed [citation]

PMID:: 23220543

See all PubMed Citations (3)

Details of each submission

From Invitae, SCV000965522.4

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (3)

Description

This variant results in the deletion of part of exon 18 (c.2562-3_2584del) of the EVC gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in EVC are known to be pathogenic (PMID: 23220543). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with EVC-related conditions. ClinVar contains an entry for this variant (Variation ID: 666179). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Last Updated: Mar 5, 2024

ClinVar

Relating variation to medicine