NM_000321.3(RB1):c.45_76del (p.Ala17fs) AND Retinoblastoma

Germline classification:: Pathogenic (2 submissions)
Last evaluated:: May 20, 2024
Review status:: 2 stars out of maximum of 4 stars
criteria provided, multiple submitters, no conflicts

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000816353.6

Allele description [Variation Report for NM_000321.3(RB1):c.45_76del (p.Ala17fs)]

NM_000321.3(RB1):c.45_76del (p.Ala17fs)

Gene:

RB1:RB transcriptional corepressor 1 [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

13q14.2

Genomic location:

Preferred name:

NM_000321.3(RB1):c.45_76del (p.Ala17fs)

HGVS:

NC_000013.11:g.48303957_48303988del
NG_009009.1:g.5211_5242del
NM_000321.3:c.45_76delMANE SELECT
NP_000312.2:p.Ala17fs
LRG_517:g.5211_5242del
NC_000013.10:g.48878081_48878112del
NC_000013.10:g.48878093_48878124del
NM_000321.2:c.45_76delTGCCGCCGCGGAACCCCCGGCACCGCCGCCGC

Protein change:

A17fs

Links:

dbSNP: rs1593412002

NCBI 1000 Genomes Browser:

rs1593412002

Molecular consequence:

NM_000321.3:c.45_76del - frameshift variant - [Sequence Ontology: SO:0001589]

Observations:

Condition(s)

Name:: Retinoblastoma (RB1)
Synonyms:: Eye cancer, retinoblastoma; RETINOBLASTOMA, SOMATIC
Identifiers:: MONDO: MONDO:0008380; MeSH: D012175; MedGen: C0035335; Orphanet: 790; OMIM: 180200; Human Phenotype Ontology: HP:0009919

Recent activity

Clear Turn Off Turn On

Microarray technology comparison (3OPHs version 1)
Microarray technology comparison (3OPHs version 1)
Accession: GDS222

GEO DataSets
Related DataSets for GEO Profiles (Select 1018719) (1)
GEO DataSets

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000956856	Labcorp Genetics (formerly Invitae), Labcorp	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Pathogenic (May 30, 2022)	germline	clinical testing	PubMed (3) [See all records that cite these PMIDs] 17096365, 31106028, 28492532
SCV005046121	Genetic Diagnostic Laboratory, University of Pennsylvania School of Medicine	criteria provided, single submitter (ACMG Guidelines, 2015)	Pathogenic (May 20, 2024)	germline	clinical testing	PubMed (1) [See all records that cite this PMID]

Submission Accession

Submitter

Review Status
(Assertion method)

Clinical Significance
(Last evaluated)

Origin

Method

Citations

SCV000956856

Labcorp Genetics (formerly Invitae), Labcorp

criteria provided, single submitter

(Invitae Variant Classification Sherloc (09022015))

Pathogenic
(May 30, 2022)

germline

clinical testing

PubMed (3)
[See all records that cite these PMIDs]

SCV005046121

Genetic Diagnostic Laboratory, University of Pennsylvania School of Medicine

criteria provided, single submitter

(ACMG Guidelines, 2015)

Pathogenic
(May 20, 2024)

germline

clinical testing

PubMed (1)
[See all records that cite this PMID]

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	yes	1	not provided	not provided	not provided	not provided	clinical testing
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

Genotype-phenotype correlations in hereditary familial retinoblastoma.

Taylor M, Dehainault C, Desjardins L, Doz F, Levy C, Sastre X, Couturier J, Stoppa-Lyonnet D, Houdayer C, Gauthier-Villars M.

Hum Mutat. 2007 Mar;28(3):284-93.

PubMed [citation]

PMID:: 17096365

An Ophthalmic Targeted Exome Sequencing Panel as a Powerful Tool to Identify Causative Mutations in Patients Suspected of Hereditary Eye Diseases.

Wang P, Li S, Sun W, Xiao X, Jia X, Liu M, Xu L, Long Y, Zhang Q.

Transl Vis Sci Technol. 2019 Mar;8(2):21. doi: 10.1167/tvst.8.2.21.

PubMed [citation]

PMID:: 31106028
PMCID:: PMC6497090

See all PubMed Citations (4)

Details of each submission

From Labcorp Genetics (formerly Invitae), Labcorp, SCV000956856.4

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (3)

Description

This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Ala17Profs*3) in the RB1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RB1 are known to be pathogenic (PMID: 17096365). This premature translational stop signal has been observed in individual(s) with retinoblastoma (PMID: 31106028; Invitae). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 659361).

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Genetic Diagnostic Laboratory, University of Pennsylvania School of Medicine, SCV005046121.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	1	not provided	not provided	clinical testing	PubMed (1)

Description

Case and Pedigree Information: BILATERAL CASES:1, UNILATERAL CASES:0, TOTAL CASES:1, PEDIGREES:1. ACMG Codes Applied:PVS1, PM2

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	yes	not provided	not provided	not provided		1	not provided	not provided	not provided

Last Updated: Sep 29, 2024

ClinVar

Relating variation to medicine