U.S. flag

An official website of the United States government

NM_000138.5(FBN1):c.4177_4199del (p.Glu1393fs) AND not provided

Germline classification:
Pathogenic (1 submission)
Last evaluated:
Jan 31, 2018
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000756142.9

Allele description [Variation Report for NM_000138.5(FBN1):c.4177_4199del (p.Glu1393fs)]

NM_000138.5(FBN1):c.4177_4199del (p.Glu1393fs)

Gene:
FBN1:fibrillin 1 [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
15q21.1
Genomic location:
Preferred name:
NM_000138.5(FBN1):c.4177_4199del (p.Glu1393fs)
HGVS:
  • NC_000015.10:g.48474266_48474288del
  • NG_008805.2:g.176501_176523del
  • NM_000138.5:c.4177_4199delMANE SELECT
  • NP_000129.3:p.Glu1393fs
  • LRG_778:g.176501_176523del
  • NC_000015.9:g.48766463_48766485del
  • NM_000138.4:c.4177_4199delGAAGGATACACAGGTGATGGCTT
  • p.Glu1393fs
Protein change:
E1393fs
Links:
dbSNP: rs1566906389
NCBI 1000 Genomes Browser:
rs1566906389
Molecular consequence:
  • NM_000138.5:c.4177_4199del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Synonyms:
none provided
Identifiers:
MedGen: C3661900

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000883863ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
criteria provided, single submitter

(ARUP Molecular Germline Variant Investigation Process)
Pathogenic
(Jan 31, 2018)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories, SCV000883863.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

The FBN1 c.4177_4199del; p.Glu1393fs variant, to our knowledge, is not reported in the medical literature or gene-specific databases. This variant is also absent from general population databases (1000 Genomes Project, Exome Variant Server, and Genome Aggregation Database), indicating it is not a common polymorphism. A different variant, c.4177delG; p.Glu1393fs, has been reported in individuals and families affected with Marfan syndrome; further, in vitro functional analyses of this variant protein shows a marked reduction in fibrillin synthesis and matrix deposition as well as translation of a truncated protein product (Aoyama 1994, Schrijver 2002). Similarly, the c.4177_4199del variant causes a frameshift by deleting 23 nucleotides and is predicted to result in a truncated protein or mRNA subject to nonsense-mediated decay. Based on the above information, this variant is considered pathogenic. References: Aoyama T et al. Quantitative differences in biosynthesis and extracellular deposition of fibrillin in cultured fibroblasts distinguish five groups of Marfan syndrome patients and suggest distinct pathogenetic mechanisms. J Clin Invest. 1994 Jul;94(1):130-7. Schrijver I et al. Premature Termination Mutations in FBN1: Distinct Effects on Differential Allelic Expression and on Protein and Clinical Phenotypes. Am J Hum Genet. 2002 Aug; 71(2): 223–237.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 29, 2024