NM_000138.5(FBN1):c.4177_4199del (p.Glu1393fs) AND multiple conditions

Germline classification:: Pathogenic (1 submission)
Last evaluated:: May 14, 2018
Review status:: 1 star out of maximum of 4 stars
criteria provided, single submitter

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000693839.6

Allele description [Variation Report for NM_000138.5(FBN1):c.4177_4199del (p.Glu1393fs)]

NM_000138.5(FBN1):c.4177_4199del (p.Glu1393fs)

Gene:

FBN1:fibrillin 1 [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

15q21.1

Genomic location:

Preferred name:

NM_000138.5(FBN1):c.4177_4199del (p.Glu1393fs)

HGVS:

NC_000015.10:g.48474266_48474288del
NG_008805.2:g.176501_176523del
NM_000138.5:c.4177_4199delMANE SELECT
NP_000129.3:p.Glu1393fs
LRG_778:g.176501_176523del
NC_000015.9:g.48766463_48766485del
NM_000138.4:c.4177_4199delGAAGGATACACAGGTGATGGCTT
p.Glu1393fs

Protein change:

E1393fs

Links:

dbSNP: rs1566906389

NCBI 1000 Genomes Browser:

rs1566906389

Molecular consequence:

NM_000138.5:c.4177_4199del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Name:: Marfan syndrome (MFS)
Synonyms:: MARFAN SYNDROME, TYPE I; Marfan syndrome type 1; Marfan's syndrome; See all synonyms [MedGen]
Identifiers:: MONDO: MONDO:0007947; MedGen: C0024796; Orphanet: 284963; Orphanet: 558; OMIM: 154700

Name:: Familial thoracic aortic aneurysm and aortic dissection (TAAD)
Synonyms:: Thoracic aortic aneurysm and aortic dissection; Thoracic aortic aneurysms and dissections
Identifiers:: MONDO: MONDO:0019625; MedGen: C4707243; Orphanet: 91387; OMIM: PS607086

Recent activity

Clear Turn Off Turn On

nssv2845227 (2)
dbVar

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000822260	Labcorp Genetics (formerly Invitae), Labcorp	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Pathogenic (May 14, 2018)	germline	clinical testing	PubMed (3) [See all records that cite these PMIDs] 17657824, 19293843, 28492532

Submission Accession

Submitter

Review Status
(Assertion method)

Clinical Significance
(Last evaluated)

Origin

Method

Citations

SCV000822260

Labcorp Genetics (formerly Invitae), Labcorp

criteria provided, single submitter

(Invitae Variant Classification Sherloc (09022015))

Pathogenic
(May 14, 2018)

germline

clinical testing

PubMed (3)
[See all records that cite these PMIDs]

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

The importance of mutation detection in Marfan syndrome and Marfan-related disorders: report of 193 FBN1 mutations.

Comeglio P, Johnson P, Arno G, Brice G, Evans A, Aragon-Martin J, da Silva FP, Kiotsekoglou A, Child A.

Hum Mutat. 2007 Sep;28(9):928.

PubMed [citation]

PMID:: 17657824

Identification of the minimal combination of clinical features in probands for efficient mutation detection in the FBN1 gene.

Stheneur C, Collod-Béroud G, Faivre L, Buyck JF, Gouya L, Le Parc JM, Moura B, Muti C, Grandchamp B, Sultan G, Claustres M, Aegerter P, Chevallier B, Jondeau G, Boileau C.

Eur J Hum Genet. 2009 Sep;17(9):1121-8. doi: 10.1038/ejhg.2009.36. Epub 2009 Mar 18.

PubMed [citation]

PMID:: 19293843
PMCID:: PMC2986588

See all PubMed Citations (3)

Details of each submission

From Labcorp Genetics (formerly Invitae), Labcorp, SCV000822260.3

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (3)

Description

This sequence change creates a premature translational stop signal (p.Glu1393Hisfs*6) in the FBN1 gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with FBN1-related disease. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. Loss-of-function variants in FBN1 are known to be pathogenic (PMID: 17657824, 19293843). For these reasons, this variant has been classified as Pathogenic.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Last Updated: Sep 29, 2024

ClinVar

Relating variation to medicine