U.S. flag

An official website of the United States government

NM_003924.4(PHOX2B):c.756_776del (p.Ala254_Ala260del) AND not provided

Germline classification:
Benign (2 submissions)
Last evaluated:
May 4, 2022
Review status:
2 stars out of maximum of 4 stars
criteria provided, multiple submitters, no conflicts
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000587639.4

Allele description [Variation Report for NM_003924.4(PHOX2B):c.756_776del (p.Ala254_Ala260del)]

NM_003924.4(PHOX2B):c.756_776del (p.Ala254_Ala260del)

Genes:
PHOX2B:paired like homeobox 2B [Gene - OMIM - HGNC]
LOC110011216:paired like homeobox 2b polyalanine repeat instability region [Gene]
Variant type:
Deletion
Cytogenetic location:
4p13
Genomic location:
Preferred name:
NM_003924.4(PHOX2B):c.756_776del (p.Ala254_Ala260del)
HGVS:
  • NC_000004.11:g.41747993_41748013del
  • NC_000004.12:g.41745990_41746010del
  • NG_008243.1:g.7975_7995del
  • NG_053075.1:g.116_136del
  • NM_003924.4:c.756_776delMANE SELECT
  • NP_003915.2:p.Ala254_Ala260del
  • NP_003915.2:p.Ala254_Ala260del
  • LRG_513t1:c.756_776del
  • LRG_513:g.7975_7995del
  • LRG_513p1:p.Ala254_Ala260del
  • NC_000004.11:g.41747993_41748013del
  • NC_000004.11:g.41747993_41748013delGCCGCCGCTGCCGCTGCCGCC
  • NC_000004.11:g.41748007_41748027del
  • NC_000004.11:g.41748007_41748027del
  • NM_003924.3:c.756_776del
  • NM_003924.3:c.756_776del
  • NM_003924.3:c.756_776del21
  • NM_003924.3:c.756_776del21
  • NM_003924.3:c.756_776delGGCGGCAGCGGCAGCGGCGGC
Links:
dbSNP: rs17879189
NCBI 1000 Genomes Browser:
rs17879189
Molecular consequence:
  • NM_003924.4:c.756_776del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Synonyms:
none provided
Identifiers:
MedGen: C3661900

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000698217Women's Health and Genetics/Laboratory Corporation of America, LabCorp
criteria provided, single submitter

(LabCorp Variant Classification Summary - May 2015)
Benign
(May 17, 2016)
germlineclinical testing

LabCorp Variant Classification Summary - May 2015.docx,

Citation Link,

SCV003799603ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
criteria provided, single submitter

(ARUP Molecular Germline Variant Investigation Process 2021)
Benign
(May 4, 2022)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From Women's Health and Genetics/Laboratory Corporation of America, LabCorp, SCV000698217.1

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

Variant summary: The PHOX2B c.756_776delGGCGGCAGCGGCAGCGGCGGC (p.Ala253_Ala259del) variant causes an in-frame deletion within a repetitive alanine region. The variant of interest was observed in the large, broad control population, ExAC, with an allele frequency of 318/24632 control chromosomes (10 homozygotes, 1/77, frequency: 0.01291), which significantly exceeds the estimated maximal expected allele frequency for a pathogenic PHOX2B variant of 1/1250000 (0.0000008), suggesting this variant is a benign polymorphism. Therefore, the variant of interest is classified as Benign.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories, SCV003799603.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided
#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Oct 13, 2024