U.S. flag

An official website of the United States government

NM_000527.5(LDLR):c.663_683dup (p.Asp221_Asp227dup) AND Familial hypercholesterolemia

Germline classification:
Pathogenic (2 submissions)
Last evaluated:
Jan 8, 2024
Review status:
2 stars out of maximum of 4 stars
criteria provided, multiple submitters, no conflicts
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000586459.10

Allele description [Variation Report for NM_000527.5(LDLR):c.663_683dup (p.Asp221_Asp227dup)]

NM_000527.5(LDLR):c.663_683dup (p.Asp221_Asp227dup)

Gene:
LDLR:low density lipoprotein receptor [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
19p13.2
Genomic location:
Preferred name:
NM_000527.5(LDLR):c.663_683dup (p.Asp221_Asp227dup)
Other names:
FH Tulsa-1
HGVS:
  • NC_000019.10:g.11105569_11105589dup
  • NG_009060.1:g.21189_21209dup
  • NM_000527.5:c.663_683dupMANE SELECT
  • NM_001195798.2:c.663_683dup
  • NM_001195799.2:c.540_560dup
  • NM_001195800.2:c.314-1823_314-1803dup
  • NM_001195803.2:c.314-996_314-976dup
  • NP_000518.1:p.Asp221_Asp227dup
  • NP_001182727.1:p.Asp221_Asp227dup
  • NP_001182728.1:p.Asp180_Asp186dup
  • LRG_274:g.21189_21209dup
  • NC_000019.9:g.11216241_11216242insCGACTGCAAGGACAAATCTGA
  • NC_000019.9:g.11216245_11216265dup
  • NM_000527.4:c.663_683dup21
  • NM_000527.4:c.663_683dupCTGCAAGGACAAATCTGACGA
  • c.663_683dup
Links:
LDLR-LOVD, British Heart Foundation: LDLR_001249; dbSNP: rs879254620
NCBI 1000 Genomes Browser:
rs879254620
Molecular consequence:
  • NM_000527.5:c.663_683dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001195798.2:c.663_683dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001195799.2:c.540_560dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001195800.2:c.314-1823_314-1803dup - intron variant - [Sequence Ontology: SO:0001627]
  • NM_001195803.2:c.314-996_314-976dup - intron variant - [Sequence Ontology: SO:0001627]

Condition(s)

Name:
Familial hypercholesterolemia (FH)
Identifiers:
MONDO: MONDO:0005439; MedGen: C0020445; OMIM: PS143890

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000544677Invitae
criteria provided, single submitter

(Invitae Variant Classification Sherloc (09022015))
Pathogenic
(Jan 8, 2024)
germlineclinical testing

PubMed (6)
[See all records that cite these PMIDs]

SCV000697246Women's Health and Genetics/Laboratory Corporation of America, LabCorp
criteria provided, single submitter

(LabCorp Variant Classification Summary - May 2015)
Pathogenic
(Oct 23, 2017)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Molecular genetics of the LDL receptor gene in familial hypercholesterolemia.

Hobbs HH, Brown MS, Goldstein JL.

Hum Mutat. 1992;1(6):445-66. Review.

PubMed [citation]
PMID:
1301956

FH Tulsa-1 and -2: two unique alleles for familial hypercholesterolemia presenting in an affected two-year-old African-American male.

Blackett PR, Altmiller DH, Jelley D, Wilson DP.

Am J Med Genet. 1995 Nov 20;59(3):300-3.

PubMed [citation]
PMID:
8599353
See all PubMed Citations (6)

Details of each submission

From Invitae, SCV000544677.8

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (6)

Description

This variant, c.663_683dup, results in the insertion of 7 amino acid(s) of the LDLR protein (p.Asp221_Asp227dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with familial hypercholesterolemia and homozygous familial hypercholesterolemia (PMID: 1301956, 8599353, 9026534, 10447263, 16250003; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 251358). For these reasons, this variant has been classified as Pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

From Women's Health and Genetics/Laboratory Corporation of America, LabCorp, SCV000697246.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

Variant Summary: The c.663_683dupCTGCAAGGACAAATCTGACGA (p.Asp221_Asp227dup) variant is an in-frame duplication of 21 nucleotides and results in the in-frame duplication of 7 codons in a non-repetitive region. Mutation taster predicts benign outcome for this variant. This variant is absent in 275344 control chromosomes (gnomAD). It has been reported in several individuals in the literature with either definite homozygous FH along with a second pathogenic LDLR variant or heterozygous FH. In three publications, patients with homozygous FH were shown to have <2% LDL-r activity (Webb_1996, Hobbs_1992, Blackett_1995). In addition, multiple clinical diagnostic laboratories/reputable databases classified this variant as pathogenic/likely pathogenic. Other similar variants have been reported in association with FH in database (HGMD). Taken together, this variant is classified as pathogenic.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: May 1, 2024