NM_000059.4(BRCA2):c.8992_9025del (p.Ser2998fs) AND Hereditary cancer-predisposing syndrome

Germline classification:: Pathogenic (1 submission)
Last evaluated:: Feb 10, 2022
Review status:: 1 star out of maximum of 4 stars
criteria provided, single submitter

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000584591.4

Allele description [Variation Report for NM_000059.4(BRCA2):c.8992_9025del (p.Ser2998fs)]

NM_000059.4(BRCA2):c.8992_9025del (p.Ser2998fs)

Gene:

BRCA2:BRCA2 DNA repair associated [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

13q13.1

Genomic location:

Preferred name:

NM_000059.4(BRCA2):c.8992_9025del (p.Ser2998fs)

HGVS:

NC_000013.11:g.32379788_32379821del
NG_012772.3:g.69309_69342del
NM_000059.4:c.8992_9025delMANE SELECT
NP_000050.3:p.Ser2998fs
LRG_293:g.69309_69342del
NC_000013.10:g.32953925_32953958del
NM_000059.3:c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT

Protein change:

S2998fs

Links:

dbSNP: rs1555288450

NCBI 1000 Genomes Browser:

rs1555288450

Molecular consequence:

NM_000059.4:c.8992_9025del - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Name:: Hereditary cancer-predisposing syndrome
Synonyms:: Neoplastic Syndromes, Hereditary; Tumor predisposition; Cancer predisposition; See all synonyms [MedGen]
Identifiers:: MONDO: MONDO:0015356; MeSH: D009386; MedGen: C0027672

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000689164	Color Diagnostics, LLC DBA Color Health	criteria provided, single submitter (ACMG Guidelines, 2015)	Pathogenic (Feb 10, 2022)	germline	clinical testing	PubMed (2) [See all records that cite these PMIDs] 27616075, 25741868

Submission Accession

Submitter

Review Status
(Assertion method)

Clinical Significance
(Last evaluated)

Origin

Method

Citations

SCV000689164

Color Diagnostics, LLC DBA Color Health

criteria provided, single submitter

(ACMG Guidelines, 2015)

Pathogenic
(Feb 10, 2022)

germline

clinical testing

PubMed (2)
[See all records that cite these PMIDs]

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing

Citations

PubMed

Gene panel sequencing in familial breast/ovarian cancer patients identifies multiple novel mutations also in genes others than BRCA1/2.

Kraus C, Hoyer J, Vasileiou G, Wunderle M, Lux MP, Fasching PA, Krumbiegel M, Uebe S, Reuter M, Beckmann MW, Reis A.

Int J Cancer. 2017 Jan 1;140(1):95-102. doi: 10.1002/ijc.30428. Epub 2016 Sep 23.

PubMed [citation]

PMID:: 27616075

Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.

Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality Assurance Committee..

Genet Med. 2015 May;17(5):405-24. doi: 10.1038/gim.2015.30. Epub 2015 Mar 5.

PubMed [citation]

PMID:: 25741868
PMCID:: PMC4544753

Details of each submission

From Color Diagnostics, LLC DBA Color Health, SCV000689164.3

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (2)

Description

This variant deletes 34 nucleotides in exon 23 of the BRCA2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in individuals affected with early onset and triple-negative breast cancer (PMID: 27616075, Color internal data). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Last Updated: Sep 1, 2024

ClinVar

Relating variation to medicine