U.S. flag

An official website of the United States government

NM_000179.3(MSH6):c.3935_3954dup (p.Lys1319fs) AND Hereditary cancer-predisposing syndrome

Germline classification:
Pathogenic (1 submission)
Last evaluated:
Jun 7, 2018
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000491067.4

Allele description [Variation Report for NM_000179.3(MSH6):c.3935_3954dup (p.Lys1319fs)]

NM_000179.3(MSH6):c.3935_3954dup (p.Lys1319fs)

Gene:
MSH6:mutS homolog 6 [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
2p16.3
Genomic location:
Preferred name:
NM_000179.3(MSH6):c.3935_3954dup (p.Lys1319fs)
HGVS:
  • NC_000002.12:g.47806585_47806604dup
  • NG_007111.1:g.28439_28458dup
  • NG_008397.1:g.104072_104091dup
  • NM_000179.3:c.3935_3954dupMANE SELECT
  • NM_001281492.2:c.3545_3564dup
  • NM_001281493.2:c.3029_3048dup
  • NM_001281494.2:c.3029_3048dup
  • NP_000170.1:p.Lys1319fs
  • NP_001268421.1:p.Lys1189fs
  • NP_001268422.1:p.Lys1017fs
  • NP_001268423.1:p.Lys1017fs
  • LRG_219:g.28439_28458dup
  • NC_000002.11:g.48033723_48033724insTTATTCAAAAGGGACATAGA
  • NC_000002.11:g.48033724_48033743dup
  • NM_000179.2:c.3935_3954dupTTATTCAAAAGGGACATAGA
Protein change:
K1017fs
Links:
dbSNP: rs1553333644
NCBI 1000 Genomes Browser:
rs1553333644
Molecular consequence:
  • NM_000179.3:c.3935_3954dup - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001281492.2:c.3545_3564dup - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001281493.2:c.3029_3048dup - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_001281494.2:c.3029_3048dup - frameshift variant - [Sequence Ontology: SO:0001589]

Condition(s)

Name:
Hereditary cancer-predisposing syndrome
Synonyms:
Neoplastic Syndromes, Hereditary; Tumor predisposition; Cancer predisposition; See all synonyms [MedGen]
Identifiers:
MONDO: MONDO:0015356; MeSH: D009386; MedGen: C0027672

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000580176Ambry Genetics
criteria provided, single submitter

(Ambry Variant Classification Scheme 2023)
Pathogenic
(Jun 7, 2018)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From Ambry Genetics, SCV000580176.6

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

The c.3935_3954dup20 pathogenic mutation, located in coding exon 9 of the MSH6 gene, results from a duplication of 20 nucleotides at positions 3935 to 3954, causing a translational frameshift with a predicted alternate stop codon (p.K1319Lfs*15). This alteration was identified in a patient whose colorectal cancer exhibited loss of MSH6 on IHC (Ambry internal data). This frameshift occurs at the 3' terminus of MSH6, is not expected to trigger nonsense-mediated mRNA decay, and impacts the last 42 amino acids of the protein. The exact functional impact of these altered amino acids is unknown at this time; however, this alteration disrupts the last 16 amino acids of an important MSH6 functional domain. Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 29, 2024