U.S. flag

An official website of the United States government

NM_001379200.1(TBX1):c.1360_1381dup (p.Pro461fs) AND not provided

Germline classification:
Likely pathogenic (1 submission)
Last evaluated:
May 26, 2016
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000484091.1

Allele description [Variation Report for NM_001379200.1(TBX1):c.1360_1381dup (p.Pro461fs)]

NM_001379200.1(TBX1):c.1360_1381dup (p.Pro461fs)

Gene:
TBX1:T-box transcription factor 1 [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
22q11.21
Genomic location:
Preferred name:
NM_001379200.1(TBX1):c.1360_1381dup (p.Pro461fs)
HGVS:
  • NC_000022.11:g.19766712_19766733dup
  • NG_009229.1:g.15010_15031dup
  • NM_001379200.1:c.1360_1381dupMANE SELECT
  • NM_005992.1:c.1009+710_1009+731dup
  • NM_080646.2:c.1009+710_1009+731dup
  • NM_080647.1:c.1333_1354dup
  • NP_001366129.1:p.Pro461fs
  • NP_542378.1:p.Pro452fs
  • LRG_226t1:c.1333_1354dup
  • LRG_226:g.15010_15031dup
  • LRG_226p1:p.Pro452fs
  • NC_000022.10:g.19754235_19754256dup
  • NM_080647.1:c.1333_1354dupGGCTACCACCCGCACGCGCATC
Protein change:
P452fs
Links:
dbSNP: rs1555896828
NCBI 1000 Genomes Browser:
rs1555896828
Molecular consequence:
  • NM_001379200.1:c.1360_1381dup - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_080647.1:c.1333_1354dup - frameshift variant - [Sequence Ontology: SO:0001589]
  • NM_005992.1:c.1009+710_1009+731dup - intron variant - [Sequence Ontology: SO:0001627]
  • NM_080646.2:c.1009+710_1009+731dup - intron variant - [Sequence Ontology: SO:0001627]

Condition(s)

Synonyms:
none provided
Identifiers:
MedGen: CN517202

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000570409GeneDx
criteria provided, single submitter

(GeneDx Variant Classification (06012015))
Likely pathogenic
(May 26, 2016)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From GeneDx, SCV000570409.3

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

The c.1333_1354dup22 likely pathogenic variant in the TBX1 gene causes a frameshift starting with codon Proline 452, changes this amino acid to an Arginine residue and creates an extended Stop codon at position 172 of the new reading frame, denoted p.Pro452ArgfsX172. While the variant abolishes part of the transactivation domain (Ogata et al., 2014), it is not predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay, as the final 44 amino acids are replaced by 171 incorrect amino acids. Additionally, no downstream frameshift variants in the TBX1 gene have been reported in the Human Gene Mutation Database to our knowledge. The variant was not observed in approximately 4,900 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. The c.1333_1354dup22 variant is a strong candidate for a pathogenic variant, however the possibility it may be a rare benign variant cannot be excluded.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Apr 23, 2022