U.S. flag

An official website of the United States government

NM_000166.6(GJB1):c.526_555dup (p.Thr176_Thr185dup) AND not provided

Germline classification:
Likely pathogenic (1 submission)
Last evaluated:
Feb 17, 2017
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000480217.1

Allele description [Variation Report for NM_000166.6(GJB1):c.526_555dup (p.Thr176_Thr185dup)]

NM_000166.6(GJB1):c.526_555dup (p.Thr176_Thr185dup)

Gene:
GJB1:gap junction protein beta 1 [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
Xq13.1
Genomic location:
Preferred name:
NM_000166.6(GJB1):c.526_555dup (p.Thr176_Thr185dup)
HGVS:
  • NC_000023.11:g.71224233_71224262dup
  • NG_008357.1:g.14022_14051dup
  • NM_000166.6:c.526_555dupMANE SELECT
  • NM_001097642.3:c.526_555dup
  • NP_000157.1:p.Thr176_Thr185dup
  • NP_001091111.1:p.Thr176_Thr185dup
  • LRG_245t2:c.526_555dup
  • LRG_245:g.14022_14051dup
  • LRG_245p2:p.Thr176_Thr185dup
  • NC_000023.10:g.70444081_70444082insCACAGTGGACTGCTTCGTGTCCCGCCCCAC
  • NC_000023.10:g.70444083_70444112dup
  • NM_000166.5:c.526_555dup
  • NM_000166.5:c.526_555dupACAGTGGACTGCTTCGTGTCCCGCCCCACC
Links:
dbSNP: rs1555937221
NCBI 1000 Genomes Browser:
rs1555937221
Molecular consequence:
  • NM_000166.6:c.526_555dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001097642.3:c.526_555dup - inframe_insertion - [Sequence Ontology: SO:0001821]

Condition(s)

Synonyms:
none provided
Identifiers:
MedGen: C3661900

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Submission AccessionSubmitterReview Status
(Assertion method)
Clinical Significance
(Last evaluated)
OriginMethodCitations
SCV000573064GeneDx
criteria provided, single submitter

(GeneDx Variant Classification (06012015))
Likely pathogenic
(Feb 17, 2017)
germlineclinical testing

Citation Link

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From GeneDx, SCV000573064.4

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

A variant that is likely pathogenic has been identified in the GJB1 gene. The c.526_555dup30 variant has not been published as a pathogenic variant, nor has it been reported as a benign variant to our knowledge. The c.526_555dup30 variant is not observed in large population cohorts (Lek et al., 2016; 1000 Genomes Consortium et al., 2015; Exome Variant Server. The c.526_555dup30 variant results in an in-frame duplication of 10 amino acids denoted, p.Thr176_Thr185dup. Multiple missense variants in the duplicated region have been reported in the Human Gene Mutation Database in association with CMT1X (Stenson et al., 2014), supporting the functional importance of this region of the protein. Therefore, this variant is likely pathogenic; however, the possibility that it is benign cannot be excluded.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 29, 2024