U.S. flag

An official website of the United States government

NM_000018.4(ACADVL):c.507_527del (p.Met169_Gly175del) AND not provided

Germline classification:
Pathogenic (1 submission)
Last evaluated:
Sep 23, 2014
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV000185744.1

Allele description [Variation Report for NM_000018.4(ACADVL):c.507_527del (p.Met169_Gly175del)]

NM_000018.4(ACADVL):c.507_527del (p.Met169_Gly175del)

Gene:
ACADVL:acyl-CoA dehydrogenase very long chain [Gene - OMIM - HGNC]
Variant type:
Deletion
Cytogenetic location:
17p13.1
Genomic location:
Preferred name:
NM_000018.4(ACADVL):c.507_527del (p.Met169_Gly175del)
Other names:
NM_000018.4(ACADVL):c.507_527del; p.Met169_Gly175del
HGVS:
  • NC_000017.10:g.7124877_7124897del
  • NC_000017.11:g.7221567_7221587del
  • NG_007975.1:g.6734_6754del
  • NG_008391.2:g.3473_3493del
  • NM_000018.4:c.507_527delMANE SELECT
  • NM_001033859.3:c.441_461del
  • NM_001270447.2:c.576_596del
  • NM_001270448.2:c.279_299del
  • NP_000009.1:p.Met169_Gly175del
  • NP_001029031.1:p.Met147_Gly153del
  • NP_001257376.1:p.Met192_Gly198del
  • NP_001257377.1:p.Met93_Gly99del
  • NC_000017.10:g.7124877_7124897del
  • NC_000017.10:g.7124886_7124906del
  • NC_000017.10:g.7124886_7124906delGCATGACCTTGGCGTGGGCAT
  • NC_000017.11:g.7221567_7221587del
  • NM_000018.2:c.507_527delGCATGACCTTGGCGTGGGCAT
  • NM_000018.3:c.507_527del21
  • p.M169_G175del
Links:
dbSNP: rs796051920
NCBI 1000 Genomes Browser:
rs796051920
Molecular consequence:
  • NM_000018.4:c.507_527del - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001033859.3:c.441_461del - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001270447.2:c.576_596del - inframe_deletion - [Sequence Ontology: SO:0001822]
  • NM_001270448.2:c.279_299del - inframe_deletion - [Sequence Ontology: SO:0001822]

Condition(s)

Synonyms:
none provided
Identifiers:
MedGen: C3661900

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Help
Submission AccessionSubmitterReview Status
(Assertion method)		Clinical Significance
(Last evaluated)		OriginMethodCitations
SCV000238673GeneDx
criteria provided, single submitter

(GeneDx Variant Classification (06012015))		Pathogenic
(Sep 23, 2014) 		germlineclinical testing

Citation Link

Help

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineyesnot providednot providednot providednot providednot providedclinical testing

Details of each submission

From GeneDx, SCV000238673.2

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testingnot provided

Description

The c.507_527delGCATGACCTTGGCGTGGGCAT mutation causes an in-frame deletion of 7 amino acids starting at Methionine 169 and ending with Glycine 175, denoted Met169_Gly175del. This deletion occurs within a a region that is conserved in mammals and includes residues that are conserved across species. Missense mutations in this region (V174A, V174M) have been reported in association with very long chain acyl-CoA dehydrogenase (VLCAD) deficiency, supporting the functional importance of this region of the protein. Although this mutation has not been previously reported to our knowledge, we interpret c.507_527delGCATGACCTTGGCGTGGGCAT to be a pathogenic mutation. The variant is found in ACADVL panel(s).

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineyesnot providednot providednot providednot providednot providednot providednot provided

Last Updated: Sep 29, 2024