NM_000492.4(CFTR):c.2859_2890del (p.Leu953fs) AND Cystic fibrosis

Germline classification:: Pathogenic (5 submissions)
Last evaluated:: Mar 17, 2017
Review status:: 3 stars out of maximum of 4 stars
reviewed by expert panel

Somatic classification of clinical impact:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Somatic classification of oncogenicity:: None
Review status:: (0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided

Record status:: current
Accession:: RCV000046704.12

Allele description [Variation Report for NM_000492.4(CFTR):c.2859_2890del (p.Leu953fs)]

NM_000492.4(CFTR):c.2859_2890del (p.Leu953fs)

Gene:

CFTR:CF transmembrane conductance regulator [Gene - OMIM - HGNC]

Variant type:

Deletion

Cytogenetic location:

7q31.2

Genomic location:

Preferred name:

NM_000492.4(CFTR):c.2859_2890del (p.Leu953fs)

Other names:

2991del32

HGVS:

NC_000007.14:g.117603733_117603764del
NG_016465.4:g.142950_142981del
NM_000492.4:c.2859_2890delMANE SELECT
NP_000483.3:p.Leu953fs
LRG_663:g.142950_142981del
NC_000007.13:g.117243787_117243818del
NM_000492.3:c.2859_2890del32
NM_000492.3:c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC
p.Leu953PhefsX11

Protein change:

L953fs

Links:

dbSNP: rs397508445

NCBI 1000 Genomes Browser:

rs397508445

Molecular consequence:

NM_000492.4:c.2859_2890del - frameshift variant - [Sequence Ontology: SO:0001589]

Observations:

Condition(s)

Name:: Cystic fibrosis (CF)
Synonyms:: Mucoviscidosis
Identifiers:: MONDO: MONDO:0009061; MedGen: C0010674; Orphanet: 586; OMIM: 219700

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

Help

Submission Accession	Submitter	Review Status (Assertion method)	Clinical Significance (Last evaluated)	Origin	Method	Citations
SCV000245945	CFTR2 - CFTR2	reviewed by expert panel (Sosnay PR et al. (Nat Genet 2013))	Pathogenic (Mar 17, 2017)	germline	research	PubMed (1) [See all records that cite this PMID] Citation Link,
SCV000886233	Mendelics	criteria provided, single submitter (Mendelics Assertion Criteria 2017)	Pathogenic (Nov 5, 2018)	unknown	clinical testing	Citation Link,
SCV002194315	Invitae	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015))	Pathogenic (May 28, 2022)	germline	clinical testing	PubMed (5) [See all records that cite these PMIDs] 1695717, 7691345, 9725922, 7519167, 28492532
SCV002574064	Institute of Human Genetics, University of Leipzig Medical Center	criteria provided, single submitter (ACMG Guidelines, 2015)	Pathogenic (Sep 5, 2022)	unknown	curation	PubMed (1) [See all records that cite this PMID]
SCV002752768	Ambry Genetics	criteria provided, single submitter (Ambry Variant Classification Scheme 2023)	Pathogenic (Jun 15, 2022)	germline	clinical testing	Citation Link

Help

Summary from all submissions

Ethnicity	Origin	Affected	Individuals	Families	Chromosomes tested	Number Tested	Family history	Method
not provided	germline	yes	not provided	not provided	not provided	not provided	not provided	research
not provided	germline	unknown	not provided	not provided	not provided	not provided	not provided	clinical testing
not provided	unknown	yes	6	not provided	not provided	not provided	not provided	clinical testing, curation

Citations

PubMed

Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene.

Sosnay PR, Siklosi KR, Van Goor F, Kaniecki K, Yu H, Sharma N, Ramalho AS, Amaral MD, Dorfman R, Zielenski J, Masica DL, Karchin R, Millen L, Thomas PJ, Patrinos GP, Corey M, Lewis MH, Rommens JM, Castellani C, Penland CM, Cutting GR.

Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25.

PubMed [citation]

PMID:: 23974870
PMCID:: PMC3874936

A cluster of cystic fibrosis mutations in the first nucleotide-binding fold of the cystic fibrosis conductance regulator protein.

Cutting GR, Kasch LM, Rosenstein BJ, Zielenski J, Tsui LC, Antonarakis SE, Kazazian HH Jr.

Nature. 1990 Jul 26;346(6282):366-9.

PubMed [citation]

PMID:: 1695717

See all PubMed Citations (7)

Details of each submission

From CFTR2 - CFTR2, SCV000245945.2

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	research	PubMed (1)

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	yes	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Mendelics, SCV000886233.2

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	not provided

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	unknown	yes	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Invitae, SCV002194315.3

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	PubMed (5)

Description

This sequence change creates a premature translational stop signal (p.Leu953Phefs*11) in the CFTR gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CFTR are known to be pathogenic (PMID: 1695717, 7691345, 9725922). This variant is present in population databases (rs397508445, gnomAD 0.0009%). This premature translational stop signal has been observed in individual(s) with cystic fibrosis (PMID: 7519167). ClinVar contains an entry for this variant (Variation ID: 53581). For these reasons, this variant has been classified as Pathogenic.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

From Institute of Human Genetics, University of Leipzig Medical Center, SCV002574064.1

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	6	not provided	not provided	curation	PubMed (1)

Description

This variant was identified in 6 unrelated patients with a clinically confirmed diagnosis of cystic fibrosis. The variant was classified in the context of a project re-classifying variants in the German Cystic Fibrosis Registry (Muko.e.V.). Link: https://www.muko.info/angebote/qualitaetsmanagement/register/cf-einrichtungen/mukoweb. Criteria applied: PVS1, PS3_SUP, PM2_SUP, PM3_STR, PP4

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	unknown	yes	not provided	not provided	not provided		6	not provided	not provided	not provided

From Ambry Genetics, SCV002752768.2

#	Ethnicity	Individuals	Chromosomes Tested	Family History	Method	Citations
1	not provided	not provided	not provided	not provided	clinical testing	not provided

Description

The c.2859_2890del32 pathogenic mutation, located in coding exon 17 of the CFTR gene, results from a deletion of 32 nucleotides at nucleotide positions 2859 to 2890, causing a translational frameshift with a predicted alternate stop codon (p.L953Ffs*11). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.

#	Sample				Method		Observation
#	Origin	Affected	Number tested	Tissue	Purpose	Method	Individuals	Allele frequency	Families	Co-occurrences
1	germline	unknown	not provided	not provided	not provided		not provided	not provided	not provided	not provided

Last Updated: May 19, 2024

ClinVar

Relating variation to medicine