LOC127814297[gene] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 242

<< First< Prev

Page of 3

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 59672	GRCh38/hg38 5q21.3-33.2(chr5:106619588-156124387)x1	ABLIM3, ACSL6 +1672 more	Copy number loss	See cases	GPathogenic
Select item 149858	GRCh38/hg38 5q23.3-33.2(chr5:129847794-153353546)x3	LOC129994992, LOC129994993 +1157 more	Copy number gain	See cases	GPathogenic
Select item 57483	GRCh38/hg38 5q23.3-33.2(chr5:130860928-155321811)x3	ABLIM3, ACSL6 +1218 more	Copy number gain	See cases	GPathogenic
Select item 150685	GRCh38/hg38 5q31.3-32(chr5:141089988-149530678)x3	ABLIM3, ADRB2 +313 more	Copy number gain	See cases	GPathogenic
Select item 147500	GRCh38/hg38 5q32(chr5:145197355-148541511)x1	C5orf46, CTB-99A3.1 +82 more	Copy number loss	See cases	GPathogenic
Select item 2496423	NM_018989.2(RBM27):c.8T>C (p.Ile3Thr)	LOC127814297, LOC129994940 +1 more (I3T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2542898	NM_018989.2(RBM27):c.22G>A (p.Ala8Thr)	LOC127814297, LOC129994940 +1 more (A8T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3053504	NM_018989.2(RBM27):c.59+3G>A	LOC127814297, RBM27	Single nucleotide variant (intron variant)	RBM27-related disorder	GLikely benign
Select item 3152292	NM_018989.2(RBM27):c.188G>A (p.Gly63Asp)	LOC127814297, RBM27 (G63D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2340402	NM_018989.2(RBM27):c.315G>T (p.Glu105Asp)	LOC127814297, RBM27 (E105D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2306252	NM_018989.2(RBM27):c.388G>A (p.Glu130Lys)	LOC127814297, RBM27 (E130K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2610999	NM_018989.2(RBM27):c.407A>G (p.Lys136Arg)	LOC127814297, RBM27 (K136R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2302636	NM_018989.2(RBM27):c.442C>T (p.Arg148Trp)	LOC127814297, RBM27 (R148W)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3313263	NM_018989.2(RBM27):c.449A>G (p.Tyr150Cys)	LOC127814297, RBM27 (Y150C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2554353	NM_018989.2(RBM27):c.466T>G (p.Tyr156Asp)	LOC127814297, RBM27 (Y156D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152299	NM_018989.2(RBM27):c.469C>T (p.Arg157Cys)	LOC127814297, RBM27 (R157C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2383563	NM_018989.2(RBM27):c.526C>G (p.Leu176Val)	LOC127814297, RBM27 (L176V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152300	NM_018989.2(RBM27):c.557G>A (p.Arg186His)	LOC127814297, RBM27 (R186H)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2554009	NM_018989.2(RBM27):c.602G>T (p.Arg201Ile)	LOC127814297, RBM27 (R201I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2536655	NM_018989.2(RBM27):c.754A>C (p.Thr252Pro)	LOC127814297, RBM27 (T252P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2225377	NM_018989.2(RBM27):c.785A>G (p.Asn262Ser)	LOC127814297, RBM27 (N262S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152301	NM_018989.2(RBM27):c.973C>A (p.Pro325Thr)	LOC127814297, RBM27 (P325T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2311562	NM_018989.2(RBM27):c.1000C>T (p.Pro334Ser)	LOC127814297, RBM27 (P334S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3050808	NM_018989.2(RBM27):c.1020CCCAGGCCCGGGCCCAGGTCCAGG[1] (p.337PG[7])	LOC127814297, RBM27	Microsatellite (inframe_deletion)	RBM27-related disorder	GLikely benign
Select item 2655877	NM_018989.2(RBM27):c.1029G>A (p.Pro343=)	LOC127814297, RBM27	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 3046585	NM_018989.2(RBM27):c.1081A>T (p.Met361Leu)	LOC127814297, RBM27 (M361L)	Single nucleotide variant (missense variant)	RBM27-related disorder	GLikely benign
Select item 2276001	NM_018989.2(RBM27):c.1081A>G (p.Met361Val)	LOC127814297, RBM27 (M361V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2320970	NM_018989.2(RBM27):c.1096C>A (p.Pro366Thr)	LOC127814297, RBM27 (P366T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152289	NM_018989.2(RBM27):c.1180C>T (p.Arg394Cys)	LOC127814297, RBM27 (R394C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152290	NM_018989.2(RBM27):c.1211A>G (p.Asn404Ser)	LOC127814297, RBM27 (N404S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2535177	NM_018989.2(RBM27):c.1321G>C (p.Glu441Gln)	LOC127814297, RBM27 (E441Q)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2399412	NM_018989.2(RBM27):c.1343C>T (p.Pro448Leu)	LOC127814297, RBM27 (P448L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2246350	NM_018989.2(RBM27):c.1426C>T (p.Pro476Ser)	LOC127814297, RBM27 (P476S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2379736	NM_018989.2(RBM27):c.1433C>G (p.Pro478Arg)	LOC127814297, RBM27 (P478R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152291	NM_018989.2(RBM27):c.1531A>G (p.Thr511Ala)	LOC127814297, RBM27 (T456A +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2528929	NM_018989.2(RBM27):c.2212T>A (p.Ser738Thr)	LOC127814297, RBM27 (S683T +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2312341	NM_018989.2(RBM27):c.2273A>G (p.Asn758Ser)	LOC127814297, RBM27 (N703S +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3313264	NM_018989.2(RBM27):c.2285C>A (p.Ala762Glu)	LOC127814297, RBM27 (A707E +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152293	NM_018989.2(RBM27):c.2290C>T (p.His764Tyr)	LOC127814297, RBM27 (H764Y +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2395211	NM_018989.2(RBM27):c.2299A>T (p.Asn767Tyr)	LOC127814297, RBM27 (N767Y +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152294	NM_018989.2(RBM27):c.2579C>T (p.Ala860Val)	LOC127814297, RBM27 (A805V +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152295	NM_018989.2(RBM27):c.2685A>T (p.Lys895Asn)	LOC127814297, RBM27 (K895N +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152296	NM_018989.2(RBM27):c.2687C>T (p.Thr896Met)	LOC127814297, RBM27 (T896M +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2359657	NM_018989.2(RBM27):c.2803C>T (p.Arg935Trp)	LOC127814297, RBM27 (R880W +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2477246	NM_018989.2(RBM27):c.2827C>G (p.Arg943Gly)	LOC127814297, RBM27 (R888G +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3152297	NM_018989.2(RBM27):c.2873G>A (p.Arg958His)	LOC127814297, RBM27 (R903H +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2490810	NM_018989.2(RBM27):c.2891G>T (p.Gly964Val)	LOC127814297, RBM27 (G909V +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2285516	NM_018989.2(RBM27):c.2930C>T (p.Ala977Val)	LOC127814297, RBM27 (A922V +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2401097	NM_018989.2(RBM27):c.2951T>G (p.Ile984Ser)	LOC127814297, RBM27 (I929S +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3313262	NM_018989.2(RBM27):c.2992G>A (p.Ala998Thr)	LOC127814297, RBM27 (A998T)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2214344	NM_018989.2(RBM27):c.3019C>T (p.Arg1007Cys)	LOC127814297, RBM27 (R1007C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2248477	NM_018989.2(RBM27):c.3031A>G (p.Ile1011Val)	LOC127814297, RBM27 (I1011V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2542297	NM_018989.2(RBM27):c.3061A>G (p.Ile1021Val)	LOC127814297, RBM27 (I1021V)	Single nucleotide variant (missense variant +1 more)	not specified	GLikely benign
Select item 3152298	NM_018989.2(RBM27):c.3153T>A (p.Asp1051Glu)	LOC127814297, RBM27 (D1051E)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 1179770	NC_000005.10:g.146338727C>A	LOC127814297, POU4F3	Single nucleotide variant	not provided	GBenign
Select item 1215012	NM_002700.3(POU4F3):c.-258G>A	LOC127814297, POU4F3	Single nucleotide variant (5 prime UTR variant)	not provided	GLikely benign
Select item 351378	NM_002700.3(POU4F3):c.-79C>A	LOC127814297, POU4F3	Single nucleotide variant (5 prime UTR variant)	Autosomal dominant nonsyndromic hearing loss 15	GUncertain significance
Select item 351379	NM_002700.3(POU4F3):c.-44C>A	LOC127814297, POU4F3	Single nucleotide variant (5 prime UTR variant)	Autosomal dominant nonsyndromic hearing loss 15	GUncertain significance
Select item 907694	NM_002700.3(POU4F3):c.24G>A (p.Gln8=)	LOC127814297, POU4F3	Single nucleotide variant (synonymous variant)	Autosomal dominant nonsyndromic hearing loss 15 +1 more	GConflicting classifications of pathogenicity
Select item 2468164	NM_002700.3(POU4F3):c.26C>T (p.Pro9Leu)	LOC127814297, POU4F3 (P9L)	Single nucleotide variant (synonymous variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2974951	NM_002700.3(POU4F3):c.31G>A (p.Gly11Ser)	LOC127814297, POU4F3 (R955Q +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1508552	NM_002700.3(POU4F3):c.35T>C (p.Met12Thr)	LOC127814297, POU4F3 (M12T)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1699941	NM_002700.3(POU4F3):c.37del (p.His13fs)	LOC127814297, POU4F3 (H13fs)	Deletion (frameshift variant)	Autosomal dominant nonsyndromic hearing loss 15	GPathogenic
Select item 2790133	NM_002700.3(POU4F3):c.39C>G (p.His13Gln)	LOC127814297, POU4F3 (P958A +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1334107	NM_002700.3(POU4F3):c.54del (p.Glu18fs)	LOC127814297, POU4F3 (E18fs)	Deletion (frameshift variant)	Autosomal dominant nonsyndromic hearing loss 15	GPathogenic
Select item 2293389	NM_002700.3(POU4F3):c.54A>C (p.Glu18Asp)	LOC127814297, POU4F3 (E18D +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases +1 more	GUncertain significance
Select item 1687177	NM_002700.3(POU4F3):c.66del (p.Ser23fs)	LOC127814297, POU4F3 (S23fs)	Deletion (frameshift variant)	Autosomal dominant nonsyndromic hearing loss 15	GPathogenic
Select item 3354759	NM_002700.3(POU4F3):c.66C>T (p.Ser22=)	LOC127814297, POU4F3 (Q967*)	Single nucleotide variant (nonsense +1 more)	POU4F3-related disorder	GLikely benign
Select item 2193110	NM_002700.3(POU4F3):c.70C>T (p.Leu24=)	LOC127814297, POU4F3 (S968F)	Single nucleotide variant (missense variant +1 more)	not provided	GLikely benign
Select item 1693089	NM_002700.3(POU4F3):c.71T>G (p.Leu24Arg)	LOC127814297, POU4F3 (L24R)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2841950	NM_002700.3(POU4F3):c.78T>A (p.Ser26=)	LOC127814297, POU4F3 (W971R)	Single nucleotide variant (missense variant +1 more)	not provided	GLikely benign
Select item 2662906	NM_002700.3(POU4F3):c.85G>A (p.Glu29Lys)	LOC127814297, POU4F3 (E29K +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 44583	NM_002700.3(POU4F3):c.90C>T (p.Ala30=)	LOC127814297, POU4F3	Single nucleotide variant (synonymous variant)	not specified +2 more	GBenign
Select item 667156	NM_002700.3(POU4F3):c.96C>A (p.Arg32=)	LOC127814297, POU4F3	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1513544	NM_002700.3(POU4F3):c.98G>A (p.Arg33Gln)	LOC127814297, POU4F3 (R33Q)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3216957	NM_002700.3(POU4F3):c.100G>C (p.Val34Leu)	LOC127814297, POU4F3 (V34L +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 164978	NM_002700.3(POU4F3):c.103T>C (p.Cys35Arg)	LOC127814297, POU4F3 (C35R)	Single nucleotide variant (missense variant)	not specified +1 more	GUncertain significance
Select item 351380	NM_002700.3(POU4F3):c.113C>A (p.Ala38Asp)	LOC127814297, POU4F3 (A38D)	Single nucleotide variant (missense variant)	Autosomal dominant nonsyndromic hearing loss 15	GUncertain significance
Select item 444664	NM_002700.3(POU4F3):c.118C>T (p.Gln40Ter)	LOC127814297, POU4F3 (Q40*)	Single nucleotide variant (nonsense)	not provided	GLikely pathogenic
Select item 505344	NM_002700.3(POU4F3):c.120+8G>A	LOC127814297, POU4F3	Single nucleotide variant (intron variant)	not specified +1 more	GBenign/Likely benign
Select item 2973160	NM_002700.3(POU4F3):c.121-18G>A	LOC127814297, POU4F3	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2622066	NM_002700.3(POU4F3):c.146T>G (p.Phe49Cys)	LOC127814297, POU4F3 (F49C)	Single nucleotide variant (3 prime UTR variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 2550506	NM_002700.3(POU4F3):c.161T>A (p.Leu54Gln)	LOC127814297, POU4F3 (L54Q)	Single nucleotide variant (3 prime UTR variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 3216958	NM_002700.3(POU4F3):c.166C>A (p.Arg56Ser)	LOC127814297, POU4F3 (R56S)	Single nucleotide variant (3 prime UTR variant +1 more)	Inborn genetic diseases	GUncertain significance
Select item 3343555	NM_002700.3(POU4F3):c.168C>T (p.Arg56=)	LOC127814297, POU4F3	Single nucleotide variant (3 prime UTR variant +1 more)	not provided	GUncertain significance
Select item 1706322	NM_002700.3(POU4F3):c.170C>G (p.Ala57Gly)	LOC127814297, POU4F3 (A57G)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2030117	NM_002700.3(POU4F3):c.171C>T (p.Ala57=)	LOC127814297, POU4F3	Single nucleotide variant (3 prime UTR variant +1 more)	not provided	GLikely benign
Select item 618334	NM_002700.3(POU4F3):c.171C>G (p.Ala57=)	LOC127814297, POU4F3	Single nucleotide variant (synonymous variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 904353	NM_002700.3(POU4F3):c.182C>A (p.Ala61Glu)	LOC127814297, POU4F3 (A61E)	Single nucleotide variant (missense variant)	Autosomal dominant nonsyndromic hearing loss 15	GUncertain significance
Select item 973500	NM_002700.3(POU4F3):c.184del (p.Ala62fs)	LOC127814297, POU4F3 (A62fs)	Deletion (frameshift variant)	Autosomal dominant nonsyndromic hearing loss 15	GPathogenic
Select item 1483480	NM_002700.3(POU4F3):c.184G>T (p.Ala62Ser)	LOC127814297, POU4F3 (A62S)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 179962	NM_002700.3(POU4F3):c.192T>C (p.Asp64=)	POU4F3, LOC127814297	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 1220429	NM_002700.3(POU4F3):c.195C>T (p.Ile65=)	LOC127814297, POU4F3	Single nucleotide variant (synonymous variant)	not provided	GBenign/Likely benign
Select item 2842637	NM_002700.3(POU4F3):c.205G>T (p.Gly69Cys)	LOC127814297, POU4F3 (G69C)	Single nucleotide variant (3 prime UTR variant +1 more)	not provided	GUncertain significance
Select item 2635799	NM_002700.3(POU4F3):c.205G>A (p.Gly69Ser)	LOC127814297, POU4F3 (G69S)	Single nucleotide variant (3 prime UTR variant +1 more)	POU4F3-related disorder	GUncertain significance
Select item 3342113	NM_002700.3(POU4F3):c.206G>T (p.Gly69Val)	LOC127814297, POU4F3 (G69V)	Single nucleotide variant (3 prime UTR variant +1 more)	not provided	GUncertain significance
Select item 1314251	NM_002700.3(POU4F3):c.207C>T (p.Gly69=)	LOC127814297, POU4F3	Single nucleotide variant (synonymous variant)	not provided	GUncertain significance
Select item 546983	NM_002700.3(POU4F3):c.214C>G (p.His72Asp)	LOC127814297, POU4F3 (H72D)	Single nucleotide variant (missense variant)	Hearing impairment +3 more	GConflicting classifications of pathogenicity
Select item 741239	NM_002700.3(POU4F3):c.228C>T (p.Pro76=)	LOC127814297, POU4F3	Single nucleotide variant (synonymous variant)	not provided	GConflicting classifications of pathogenicity
Select item 504671	NM_002700.3(POU4F3):c.230A>G (p.Asp77Gly)	LOC127814297, POU4F3 (D77G)	Single nucleotide variant (missense variant)	not provided +1 more	GConflicting classifications of pathogenicity

<< First< Prev

Page of 3