CELSR1[gene] and "single gene"[properties] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 501

<< First< Prev

Page of 6

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 777752	NM_001378328.1(CELSR1):c.9042TAATGAAACTTCAATTTGAACCATCAG[1] (p.Gly3013_Ter3020=)	CELSR1	Microsatellite (no sequence alteration +1 more)	not provided	GBenign
Select item 2387957	NM_001378328.1(CELSR1):c.9020A>C (p.Asp3007Ala)	CELSR1 (D3007A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2260848	NM_001378328.1(CELSR1):c.9009C>A (p.Ser3003Arg)	CELSR1 (S3003R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2353461	NM_001378328.1(CELSR1):c.8999G>A (p.Arg3000His)	CELSR1 (R3000H)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2336521	NM_001378328.1(CELSR1):c.8990T>C (p.Met2997Thr)	CELSR1 (M2997T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 720966	NM_001378328.1(CELSR1):c.8988C>G (p.Ala2996=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 3046159	NM_001378328.1(CELSR1):c.8979C>T (p.Asn2993=)	CELSR1	Single nucleotide variant (synonymous variant)	CELSR1-related disorder	GLikely benign
Select item 782760	NM_001378328.1(CELSR1):c.8961G>A (p.Pro2987=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 777753	NM_001378328.1(CELSR1):c.8947C>G (p.Pro2983Ala)	CELSR1 (P2983A)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 3340820	NM_001378328.1(CELSR1):c.8909G>A (p.Gly2970Asp)	CELSR1 (G2970D)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2239339	NM_001378328.1(CELSR1):c.8900C>T (p.Ser2967Phe)	CELSR1 (S2967F)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 716653	NM_001378328.1(CELSR1):c.8886_8897del (p.Arg2965_Ser2968del)	CELSR1	Deletion (inframe_deletion)	not provided	GBenign
Select item 3036476	NM_001378328.1(CELSR1):c.8892G>A (p.Ser2964=)	CELSR1	Single nucleotide variant (synonymous variant)	CELSR1-related disorder	GLikely benign
Select item 781530	NM_001378328.1(CELSR1):c.8891C>T (p.Ser2964Leu)	CELSR1 (S2964L)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 3142021	NM_001378328.1(CELSR1):c.8863G>A (p.Ala2955Thr)	CELSR1 (A2955T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2355670	NM_001378328.1(CELSR1):c.8852G>A (p.Arg2951Gln)	CELSR1 (R2951Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2339019	NM_001378328.1(CELSR1):c.8851C>T (p.Arg2951Trp)	CELSR1 (R2951W)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2392364	NM_001378328.1(CELSR1):c.8845C>T (p.Arg2949Trp)	CELSR1 (R2949W)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1257697	NM_001378328.1(CELSR1):c.8842G>A (p.Gly2948Ser)	CELSR1 (G2948S)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 3142020	NM_001378328.1(CELSR1):c.8834C>T (p.Thr2945Met)	CELSR1 (T2945M)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1226210	NM_001378328.1(CELSR1):c.8826G>A (p.Thr2942=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 2458080	NM_001378328.1(CELSR1):c.8825C>T (p.Thr2942Met)	CELSR1 (T2942M)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2653306	NM_001378328.1(CELSR1):c.8813C>A (p.Pro2938Gln)	CELSR1 (P2938Q)	Single nucleotide variant (missense variant)	not provided +1 more	GConflicting classifications of pathogenicity
Select item 423493	NM_001378328.1(CELSR1):c.8807C>T (p.Pro2936Leu)	CELSR1 (P2936L)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 828040	NM_001378328.1(CELSR1):c.8719dup (p.Asp2907fs)	CELSR1 (D2907fs)	Duplication (frameshift variant)	not provided	GUncertain significance
Select item 1176447	NM_001378328.1(CELSR1):c.8718G>A (p.Pro2906=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 3056526	NM_001378328.1(CELSR1):c.8707G>C (p.Glu2903Gln)	CELSR1 (E2903Q)	Single nucleotide variant (missense variant)	CELSR1-related disorder	GBenign
Select item 2343994	NM_001378328.1(CELSR1):c.8681G>T (p.Arg2894Leu)	CELSR1 (R2894L)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2376615	NM_001378328.1(CELSR1):c.8680C>T (p.Arg2894Cys)	CELSR1 (R2894C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 710168	NM_001378328.1(CELSR1):c.8679C>T (p.His2893=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2256484	NM_001378328.1(CELSR1):c.8669T>C (p.Val2890Ala)	CELSR1 (V2890A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3142019	NM_001378328.1(CELSR1):c.8668G>A (p.Val2890Met)	CELSR1 (V2890M)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2396709	NM_001378328.1(CELSR1):c.8657C>T (p.Thr2886Ile)	CELSR1 (T2886I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2258284	NM_001378328.1(CELSR1):c.8641C>T (p.Arg2881Cys)	CELSR1 (R2881C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2380290	NM_001378328.1(CELSR1):c.8630G>T (p.Ser2877Ile)	CELSR1 (S2877I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3351539	NM_001378328.1(CELSR1):c.8618G>A (p.Ser2873Asn)	CELSR1 (S2873N)	Single nucleotide variant (missense variant)	CELSR1-related disorder	GUncertain significance
Select item 2547001	NM_001378328.1(CELSR1):c.8617A>C (p.Ser2873Arg)	CELSR1 (S2873R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3142018	NM_001378328.1(CELSR1):c.8593G>A (p.Asp2865Asn)	CELSR1 (D2865N)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2271765	NM_001378328.1(CELSR1):c.8589G>T (p.Trp2863Cys)	CELSR1 (W2863C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2230509	NM_001378328.1(CELSR1):c.8584G>A (p.Gly2862Ser)	CELSR1 (G2862S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2653307	NM_001378328.1(CELSR1):c.8579C>T (p.Pro2860Leu)	CELSR1 (P2860L)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 2224602	NM_001378328.1(CELSR1):c.8575G>A (p.Val2859Ile)	CELSR1 (V2859I)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 3352263	NM_001378328.1(CELSR1):c.8555-10C>G	CELSR1	Single nucleotide variant (intron variant)	CELSR1-related disorder	GLikely benign
Select item 1344531	NM_001378328.1(CELSR1):c.8554+2T>C	CELSR1	Single nucleotide variant (splice donor variant)	See cases	GUncertain significance
Select item 2257096	NM_001378328.1(CELSR1):c.8548C>T (p.Pro2850Ser)	CELSR1 (P2850S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3142017	NM_001378328.1(CELSR1):c.8536G>A (p.Val2846Ile)	CELSR1 (V2846I)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 3257461	NM_001378328.1(CELSR1):c.8527del (p.Arg2843fs)	CELSR1 (R2843fs)	Deletion (frameshift variant)	not provided	GUncertain significance
Select item 2629469	NM_001378328.1(CELSR1):c.8474C>T (p.Ser2825Leu)	CELSR1 (S2825L)	Single nucleotide variant (missense variant)	CELSR1-related disorder	GUncertain significance
Select item 2521964	NM_001378328.1(CELSR1):c.8444A>T (p.Glu2815Val)	CELSR1 (E2815V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 709008	NM_001378328.1(CELSR1):c.8415C>T (p.Ser2805=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 2596494	NM_001378328.1(CELSR1):c.8398C>T (p.Pro2800Ser)	CELSR1 (P2800S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3060193	NM_001378328.1(CELSR1):c.8390G>C (p.Cys2797Ser)	CELSR1 (C2797S)	Single nucleotide variant (missense variant)	CELSR1-related disorder	GBenign
Select item 3142016	NM_001378328.1(CELSR1):c.8384G>T (p.Arg2795Met)	CELSR1 (R2795M)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 725656	NM_001378328.1(CELSR1):c.8367C>T (p.Asp2789=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 3265738	NM_001378328.1(CELSR1):c.8356G>A (p.Gly2786Arg)	CELSR1 (G2786R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 777754	NM_001378328.1(CELSR1):c.8319G>A (p.Lys2773=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 787510	NM_001378328.1(CELSR1):c.8300+8C>T	CELSR1	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2401678	NM_001378328.1(CELSR1):c.8296G>A (p.Val2766Ile)	CELSR1 (V2766I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3142015	NM_001378328.1(CELSR1):c.8294T>A (p.Ile2765Asn)	CELSR1 (I2765N)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2653308	NM_001378328.1(CELSR1):c.8282C>T (p.Ser2761Leu)	CELSR1 (S2761L)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 3142014	NM_001378328.1(CELSR1):c.8273C>G (p.Ser2758Cys)	CELSR1 (S2758C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2613502	NM_001378328.1(CELSR1):c.8265G>C (p.Leu2755Phe)	CELSR1 (L2755F)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 451246	NM_001378328.1(CELSR1):c.8239G>A (p.Gly2747Arg)	CELSR1 (G2747R)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 785690	NM_001378328.1(CELSR1):c.8238C>T (p.Asp2746=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 3352777	NM_001378328.1(CELSR1):c.8232C>T (p.Phe2744=)	CELSR1	Single nucleotide variant (synonymous variant)	CELSR1-related disorder	GLikely benign
Select item 2579821	NM_001378328.1(CELSR1):c.8225C>A (p.Thr2742Asn)	CELSR1 (T2742N)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3037300	NM_001378328.1(CELSR1):c.8193C>T (p.Ala2731=)	CELSR1	Single nucleotide variant (synonymous variant)	CELSR1-related disorder	GBenign
Select item 2653309	NM_001378328.1(CELSR1):c.8130G>A (p.Lys2710=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2653310	NM_001378328.1(CELSR1):c.8126G>A (p.Arg2709Gln)	CELSR1 (R2709Q)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 3044181	NM_001378328.1(CELSR1):c.8125C>G (p.Arg2709Gly)	CELSR1 (R2709G)	Single nucleotide variant (missense variant)	CELSR1-related disorder	GLikely benign
Select item 1287151	NM_001378328.1(CELSR1):c.8107G>A (p.Val2703Met)	CELSR1 (V2703M)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 3142013	NM_001378328.1(CELSR1):c.8089G>A (p.Val2697Ile)	CELSR1 (V2697I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 420666	NM_001378328.1(CELSR1):c.8089G>T (p.Val2697Phe)	CELSR1 (V2697F)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3049415	NM_001378328.1(CELSR1):c.8079+9C>T	CELSR1	Single nucleotide variant (intron variant)	CELSR1-related disorder	GLikely benign
Select item 2653311	NM_001378328.1(CELSR1):c.8051A>G (p.Tyr2684Cys)	CELSR1 (Y2684C)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 3142012	NM_001378328.1(CELSR1):c.8032G>A (p.Asp2678Asn)	CELSR1 (D2678N)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3056790	NM_001378328.1(CELSR1):c.8013G>T (p.Gly2671=)	CELSR1	Single nucleotide variant (synonymous variant)	CELSR1-related disorder	GLikely benign
Select item 2388971	NM_001378328.1(CELSR1):c.7996G>A (p.Ala2666Thr)	CELSR1 (A2666T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3142011	NM_001378328.1(CELSR1):c.7994G>A (p.Ser2665Asn)	CELSR1 (S2665N)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 780661	NM_001378328.1(CELSR1):c.7971A>G (p.Ala2657=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 2628390	NM_001378328.1(CELSR1):c.7961T>C (p.Leu2654Pro)	CELSR1 (L2654P)	Single nucleotide variant (missense variant)	CELSR1-related disorder	GUncertain significance
Select item 2653312	NM_001378328.1(CELSR1):c.7955C>A (p.Ser2652Tyr)	CELSR1 (S2652Y)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 3142010	NM_001378328.1(CELSR1):c.7868T>C (p.Ile2623Thr)	CELSR1 (I2623T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3142009	NM_001378328.1(CELSR1):c.7859G>A (p.Gly2620Glu)	CELSR1 (G2620E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2499853	NM_001378328.1(CELSR1):c.7805_7806delinsAA (p.Phe2602Ter)	CELSR1 (F2602*)	Indel (nonsense)	not provided	GUncertain significance
Select item 715988	NM_001378328.1(CELSR1):c.7806C>T (p.Phe2602=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2580939	NM_001378328.1(CELSR1):c.7797C>A (p.Asn2599Lys)	CELSR1 (N2599K)	Single nucleotide variant (missense variant)	Lymphatic malformation 9	GUncertain significance
Select item 2280833	NM_001378328.1(CELSR1):c.7792G>A (p.Gly2598Arg)	CELSR1 (G2598R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2370734	NM_001378328.1(CELSR1):c.7780C>G (p.Pro2594Ala)	CELSR1 (P2594A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2653313	NM_001378328.1(CELSR1):c.7771G>A (p.Gly2591Ser)	CELSR1 (G2591S)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3045331	NM_001378328.1(CELSR1):c.7760-4T>G	CELSR1	Single nucleotide variant (intron variant)	CELSR1-related disorder	GLikely benign
Select item 3057040	NM_001378328.1(CELSR1):c.7728C>T (p.Val2576=)	CELSR1	Single nucleotide variant (synonymous variant)	CELSR1-related disorder	GBenign
Select item 3237440	NM_001378328.1(CELSR1):c.7715G>A (p.Arg2572Gln)	CELSR1 (R2572Q)	Single nucleotide variant (missense variant)	Lymphatic malformation 9	GUncertain significance
Select item 2329852	NM_001378328.1(CELSR1):c.7711A>G (p.Met2571Val)	CELSR1 (M2571V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2307804	NM_001378328.1(CELSR1):c.7699G>A (p.Asp2567Asn)	CELSR1 (D2567N)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2653314	NM_001378328.1(CELSR1):c.7641C>T (p.Ala2547=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1341349	NM_001378328.1(CELSR1):c.7640C>T (p.Ala2547Val)	CELSR1 (A2547V)	Single nucleotide variant (missense variant)	Lymphatic malformation 9	GUncertain significance
Select item 2653315	NM_001378328.1(CELSR1):c.7638T>C (p.Phe2546=)	CELSR1	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2571163	NM_001378328.1(CELSR1):c.7627A>G (p.Met2543Val)	CELSR1 (M2543V)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 3142007	NM_001378328.1(CELSR1):c.7343C>T (p.Thr2448Ile)	CELSR1 (T2448I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance

<< First< Prev

Page of 6