VCV000279892.43 - ClinVar

NM_001372044.2(SHANK3):c.3989_4001del (p.Arg1330fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(10)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001372044.2(SHANK3):c.3989_4001del (p.Arg1330fs)

Variation ID: 279892 Accession: VCV000279892.43

Type and length

Deletion, 13 bp

Location

Cytogenetic: 22q13.33 22: 50721586-50721598 (GRCh38) [ NCBI UCSC ] 22: 51160014-51160026 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Dec 6, 2016	Oct 20, 2024	Dec 5, 2022

HGVS

Nucleotide	Protein	Molecular consequence
NM_001372044.2:c.3989_4001del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001358973.1:p.Arg1330fs	frameshift
NM_033517.1:c.3764_3776del	NP_277052.1:p.Arg1255fs	frameshift
NM_033517.1:c.3764_3776del13		frameshift
NM_033517.1:c.3764_3776delGGGCCCAGCCCCC	NP_277052.1:p.Arg1255Leufs	frameshift
NC_000022.11:g.50721597_50721609del
NC_000022.10:g.51160025_51160037del
NG_070230.1:g.57381_57393del

... more HGVS ... less HGVS

Protein change

R1255fs, R1330fs

Other names

NM_001080420.1:c.3812_3824del

Canonical SPDI

NC_000022.11:50721585:GCCCAGCCCCCGGGCCCAGCCCCC:GCCCAGCCCCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA10603393 dbSNP: rs886041238 VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
SHANK3		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh38 GRCh37	856	1086

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
not provided	Pathogenic (4)	criteria provided, multiple submitters, no conflicts	Jun 9, 2022	RCV000269712.31
SHANK3-related disorder	not provided (1)	no classification provided	-	RCV000845003.5
Phelan-McDermid syndrome	Pathogenic (2)	criteria provided, multiple submitters, no conflicts	Jan 17, 2019	RCV001249687.10
Intellectual disability	Pathogenic (1)	criteria provided, single submitter	Apr 20, 2020	RCV001257673.5
Inborn genetic diseases	Pathogenic (1)	criteria provided, single submitter	Jan 27, 2020	RCV001267260.8
See cases	Pathogenic (1)	criteria provided, single submitter	Dec 5, 2022	RCV003128400.4

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Jun 09, 2022)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV000329517.9 First in ClinVar: Dec 06, 2016 Last updated: Mar 04, 2023	Comment: Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not … (more) Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25188300, 29719671, 28135719) (less)
Pathogenic (Jan 01, 2021)	criteria provided, single submitter (CeGaT Center For Human Genetics Tuebingen Variant Classification Criteria Version 2) Method: clinical testing	not provided Affected status: yes Allele origin: germline	CeGaT Center for Human Genetics Tuebingen Accession: SCV001500270.23 First in ClinVar: Mar 14, 2021 Last updated: Oct 20, 2024	Number of individuals with the variant: 1
Pathogenic (Jan 17, 2019)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Phelan-McDermid syndrome Affected status: yes Allele origin: germline	Institute for Genomic Medicine (IGM) Clinical Laboratory, Nationwide Children's Hospital Accession: SCV001423683.1 First in ClinVar: Jul 25, 2020 Last updated: Jul 25, 2020	Comment: [ACMG/AMP: PVS1, PS2, PM2] This alteration is a null variant in a gene where LOF is a known mechanism of disease [PVS1], is de novo … (more) [ACMG/AMP: PVS1, PS2, PM2] This alteration is a null variant in a gene where LOF is a known mechanism of disease [PVS1], is de novo in origin as it was not detected in the submitted parental specimens (identity confirmed) [PS2], is absent from or rarely observed in large-scale population databases [PM2]. (less)
Pathogenic (Apr 20, 2020)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Intellectual disability (Autosomal dominant inheritance) Affected status: yes Allele origin: de novo	Diagnostic Laboratory, Strasbourg University Hospital Accession: SCV001434484.1 First in ClinVar: Oct 03, 2020 Last updated: Oct 03, 2020	Clinical Features: Slight intellectual disability (present) , hypotonia (present) , normal MRI (present) , delayed walking (18 months old) (present) Age: 0-9 years Sex: male Tissue: blood Method: targeted capture
Pathogenic (Oct 23, 2020)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	not provided (Unknown mechanism) Affected status: yes Allele origin: germline	Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen Accession: SCV001448080.1 First in ClinVar: Nov 28, 2020 Last updated: Nov 28, 2020	Clinical Features: Autism (present) , Intellectual disability (present) Sex: male
Pathogenic (-)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	PHELAN-MCDERMID SYNDROME Affected status: yes Allele origin: germline	Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego Study: CSER-NYCKidSeq Accession: SCV001977612.1 First in ClinVar: Oct 16, 2021 Last updated: Oct 16, 2021	Comment: This nonsense variant found in exon 21 of 22 is predicted to result in loss of normal protein function through either protein truncation or nonsense-mediated … (more) This nonsense variant found in exon 21 of 22 is predicted to result in loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay (NMD). De novo deletions, of a similar size to the one identified in this individual, have been previously reported in individuals affected with Phelan McDermid syndrome (PMID: 29719671, 25188300, 28135719). It is absent from the gnomAD population database and thus is presumed to be rare. Analysis of the parental samples was negative for the variant, indicating this variant likely occurred as a de novo event. Based on the available evidence, the c.3812_3824del (p.Arg1271LeufsTer25) variant is classified as Pathogenic. (less)
Pathogenic (Dec 05, 2022)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	see cases Affected status: yes Allele origin: unknown	Institute of Human Genetics, University Hospital Muenster Accession: SCV003804873.1 First in ClinVar: Mar 04, 2023 Last updated: Mar 04, 2023	Comment: ACMG categories: PVS1,PS5,PP5 Number of individuals with the variant: 1 Clinical Features: Delayed speech and language development (present) , Global developmental delay (present) , Hypotonia (present) Age: 0-9 years Sex: male Tissue: blood
Pathogenic (Jan 27, 2020)	criteria provided, single submitter (Ambry Variant Classification Scheme 2023) Method: clinical testing	Inborn genetic diseases Affected status: unknown Allele origin: germline	Ambry Genetics Accession: SCV001445441.4 First in ClinVar: Nov 21, 2020 Last updated: May 01, 2024	Publications: PubMed (3) PubMed: 25188300‚ 28135719‚ 29719671 Comment: The alteration results in a premature stop codon: _x000D_ _x000D_ The c.3764_3776del13 (p.R1255Lfs25) alteration, located in coding exon 21 of the SHANK3 gene, results from … (more) The alteration results in a premature stop codon: _x000D_ _x000D_ The c.3764_3776del13 (p.R1255Lfs25) alteration, located in coding exon 21 of the SHANK3 gene, results from a deletion of 13 nucleotides from position 3764 to 3776, causing a translational frameshift with a predicted alternate stop codon after 25 amino acids. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. The alteration has been observed in affected individuals: _x000D_ _x000D_ The alteration has been reported as a de novo occurrence in individuals with a diagnosis of, or features consistent with, Phelan-McDermid Syndrome (De Rubeis, 2018; Leblond, 2014), as well as in an individual with an unspecified developmental disorder (Deciphering Developmental Disorders Study, 2017). Based on the available evidence, this alteration is classified as pathogenic. (less)
Pathogenic (Apr 20, 2021)	no assertion criteria provided Method: clinical testing	not provided Affected status: yes Allele origin: de novo	Molecular Genetics laboratory, Necker Hospital Accession: SCV004031368.1 First in ClinVar: Sep 03, 2023 Last updated: Sep 03, 2023	Clinical Features: Intellectual disability (present)
not provided (-)	no classification provided Method: phenotyping only	SHANK3-Related Disorder Affected status: yes Allele origin: de novo	GenomeConnect, ClinGen Accession: SCV000986833.1 First in ClinVar: Aug 31, 2019 Last updated: Aug 31, 2019	Comment: Variant interpretted as pathogenic and reported on 05/17/2018 by GTR ID 26957. GenomeConnect assertions are reported exactly as they appear on the patient-provided report from … (more) Variant interpretted as pathogenic and reported on 05/17/2018 by GTR ID 26957. GenomeConnect assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. GenomeConnect staff make no attempt to reinterpret the clinical significance of the variant. (less) Clinical Features: Decreased fetal movement (present) , Obesity (present) , Diabetes insipidus (present) , Hyperthyroidism (present) , Abnormality of the oral cavity (present) , Abnormality of the … (more) Decreased fetal movement (present) , Obesity (present) , Diabetes insipidus (present) , Hyperthyroidism (present) , Abnormality of the oral cavity (present) , Abnormality of the skull (present) , Oral-pharyngeal dysphagia (present) , Abnormality of globe size (present) , Congenital ocular coloboma (present) , Abnormality of vision (present) , Abnormality of the optic nerve (present) , Abnormal retinal morphology (present) , Abnormality of the nervous system (present) , Cognitive impairment (present) , EEG abnormality (present) , Generalized hypotonia (present) , Seizures (present) , Hypohidrosis (present) , Abnormality of the curvature of the vertebral column (present) , Joint hypermobility (present) , Hip dysplasia (present) , Abnormality of muscle physiology (present) , Abnormality of the musculature of the limbs (present) , Abnormality of the musculature (present) , Abnormality of the musculature of the pelvis (present) , Feeding difficulties (present) , Abnormality of esophagus morphology (present) , Abnormality of the large intestine (present) (less) Age: 0-9 years Sex: female Method: Sanger Sequencing Testing laboratory: GeneDx Date variant was reported to submitter: 2018-05-17 Testing laboratory interpretation: Pathogenic

Comment:

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25188300, 29719671, 28135719)

Comment:

[ACMG/AMP: PVS1, PS2, PM2] This alteration is a null variant in a gene where LOF is a known mechanism of disease [PVS1], is de novo in origin as it was not detected in the submitted parental specimens (identity confirmed) [PS2], is absent from or rarely observed in large-scale population databases [PM2].

Comment:

This nonsense variant found in exon 21 of 22 is predicted to result in loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay (NMD). De novo deletions, of a similar size to the one identified in this individual, have been previously reported in individuals affected with Phelan McDermid syndrome (PMID: 29719671, 25188300, 28135719). It is absent from the gnomAD population database and thus is presumed to be rare. Analysis of the parental samples was negative for the variant, indicating this variant likely occurred as a de novo event. Based on the available evidence, the c.3812_3824del (p.Arg1271LeufsTer25) variant is classified as Pathogenic.

Comment:

The alteration results in a premature stop codon: _x000D_ _x000D_ The c.3764_3776del13 (p.R1255Lfs*25) alteration, located in coding exon 21 of the SHANK3 gene, results from a deletion of 13 nucleotides from position 3764 to 3776, causing a translational frameshift with a predicted alternate stop codon after 25 amino acids. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. The alteration has been observed in affected individuals: _x000D_ _x000D_ The alteration has been reported as a de novo occurrence in individuals with a diagnosis of, or features consistent with, Phelan-McDermid Syndrome (De Rubeis, 2018; Leblond, 2014), as well as in an individual with an unspecified developmental disorder (Deciphering Developmental Disorders Study, 2017). Based on the available evidence, this alteration is classified as pathogenic.

Comment:

Variant interpretted as pathogenic and reported on 05/17/2018 by GTR ID 26957. GenomeConnect assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. GenomeConnect staff make no attempt to reinterpret the clinical significance of the variant.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Delineation of the genetic and clinical spectrum of Phelan-McDermid syndrome caused by SHANK3 point mutations.	De Rubeis S	Molecular autism	2018	PMID: 29719671
Prevalence and architecture of de novo mutations in developmental disorders.	Deciphering Developmental Disorders Study	Nature	2017	PMID: 28135719
Meta-analysis of SHANK Mutations in Autism Spectrum Disorders: a gradient of severity in cognitive impairments.	Leblond CS	PLoS genetics	2014	PMID: 25188300

Text-mined citations for rs886041238 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 20, 2024

ClinVar Genomic variation as it relates to human health

NM_001372044.2(SHANK3):c.3989_4001del (p.Arg1330fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs886041238 ...