APOBR[gene] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 124

<< First< Prev

Page of 2

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 144327	GRCh38/hg38 16p13.3-11.2(chr16:4644892-29170820)x3	ABAT, ABCC1 +851 more	Copy number gain	See cases	GPathogenic
Select item 151527	GRCh38/hg38 16p12.2-11.2(chr16:21350622-29202837)x3	APOBR, AQP8 +287 more	Copy number gain	See cases	GLikely pathogenic
Select item 58086	GRCh38/hg38 16p12.2-11.2(chr16:21463739-29249579)x3	LOC130058727, LOC130058728 +287 more	Copy number gain	See cases	GPathogenic
Select item 58099	GRCh38/hg38 16p12.2-11.2(chr16:21602183-29314373)x3	OTOA, PALB2 +280 more	Copy number gain	See cases	GPathogenic
Select item 146289	GRCh38/hg38 16p12.2-11.2(chr16:22634385-29227323)x3	APOBR, AQP8 +233 more	Copy number gain	See cases	GLikely pathogenic
Select item 58626	GRCh38/hg38 16p12.2-11.2(chr16:23047969-30632245)x3	DCTPP1, DOC2A +409 more	Copy number gain	See cases	GPathogenic
Select item 152605	GRCh38/hg38 16p12.2-11.2(chr16:23752047-31943755)x3	LOC130058732, LOC130058733 +504 more	Copy number gain	See cases	GPathogenic
Select item 151637	GRCh38/hg38 16p12.1-11.2(chr16:27311746-31193406)x3	ZNF747, ZNF747-DT +378 more	Copy number gain	See cases	GPathogenic
Select item 59990	GRCh38/hg38 16p12.1-11.2(chr16:28061312-28584375)x3	APOBR, CLN3 +25 more	Copy number gain	See cases	GUncertain significance
Select item 59292	GRCh38/hg38 16p12.1-11.2(chr16:28293803-29531653)x3	APOBR, ATP2A1 +78 more	Copy number gain	See cases	GUncertain significance
Select item 153260	GRCh38/hg38 16p12.1-11.2(chr16:28320366-29415078)x3	APOBR, ATP2A1 +72 more	Copy number gain	See cases	GUncertain significance
Select item 148782	GRCh38/hg38 16p12.1-11.2(chr16:28327346-29342070)x1	ATP2A1, APOBR +70 more	Copy number loss	See cases	GPathogenic
Select item 545197	NC_000016.10:g.(?_28351819)_(29325073_?)del	APOBR, ATP2A1 +68 more	Deletion	Schizophrenia	GPathogenic
Select item 60446	GRCh38/hg38 16p12.1-11.2(chr16:28366111-30183432)x3	LOC125146439, LOC125146440 +179 more	Copy number gain	See cases	GPathogenic
Select item 150351	GRCh38/hg38 16p12.1-11.2(chr16:28392026-29170879)x3	APOBR, ATP2A1 +61 more	Copy number gain	See cases	GUncertain significance
Select item 152023	GRCh38/hg38 16p12.1-11.2(chr16:28392832-29170875)x1	APOBR, ATP2A1 +61 more	Copy number loss	See cases	GPathogenic
Select item 151177	GRCh38/hg38 16p12.1-11.2(chr16:28392832-30320693)x1	ALDOA, APOBR +187 more	Copy number loss	See cases	GPathogenic
Select item 150642	GRCh38/hg38 16p12.1-11.2(chr16:28392832-29320029)x1	APOBR, ATP2A1 +66 more	Copy number loss	See cases	GPathogenic
Select item 148886	GRCh38/hg38 16p12.1-11.2(chr16:28392832-29342070)x1	APOBR, ATP2A1 +67 more	Copy number loss	See cases	GPathogenic
Select item 148506	GRCh38/hg38 16p12.1-11.2(chr16:28392832-30186020)x1	ALDOA, APOBR +180 more	Copy number loss	See cases	GPathogenic
Select item 58735	GRCh38/hg38 16p12.1-11.2(chr16:28456967-30295107)x1	ALDOA, APOBR +186 more	Copy number loss	See cases	GPathogenic
Select item 148497	GRCh38/hg38 16p12.1-11.2(chr16:28487211-29202837)x3	APOBR, ATP2A1 +61 more	Copy number gain	See cases	GUncertain significance
Select item 584086	NC_000016.10:g.(?_28487456)_(28595930_?)del	APOBR, CLN3 +9 more	Deletion	Neuronal ceroid lipofuscinosis	GPathogenic
Select item 154502	GRCh38/hg38 16p12.1-11.2(chr16:28492482-29170875)x3	APOBR, ATP2A1 +57 more	Copy number gain	See cases	GUncertain significance
Select item 146479	GRCh38/hg38 16p12.1-11.2(chr16:28492482-30179247)x3	ALDOA, APOBR +171 more	Copy number gain	See cases	GPathogenic
Select item 146471	GRCh38/hg38 16p12.1-11.2(chr16:28492482-29170875)x1	LOC130058739, LOC130058740 +57 more	Copy number loss	See cases	GLikely pathogenic
Select item 146463	GRCh38/hg38 16p12.1-11.2(chr16:28492482-29320029)x3	APOBR, ATP2A1 +62 more	Copy number gain	See cases	GUncertain significance
Select item 34150	GRCh38/hg38 16p12.1-11.2(chr16:28492482-30179247)x1	ALDOA, APOBR +171 more	Copy number loss	See cases	GPathogenic
Select item 3127985	NM_018690.4(APOBR):c.47G>C (p.Arg16Thr)	APOBR (R16T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3127988	NM_018690.4(APOBR):c.67G>C (p.Gly23Arg)	APOBR (G23R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2336696	NM_018690.4(APOBR):c.103C>A (p.Pro35Thr)	APOBR (P35T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3127982	NM_018690.4(APOBR):c.310G>A (p.Gly104Arg)	APOBR (G104R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2492025	NM_018690.4(APOBR):c.449A>G (p.Gln150Arg)	APOBR (Q150R)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2542048	NM_018690.4(APOBR):c.483G>C (p.Glu161Asp)	APOBR (E161D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2227056	NM_018690.4(APOBR):c.610G>A (p.Gly204Arg)	APOBR (G204R)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 3127986	NM_018690.4(APOBR):c.617C>T (p.Thr206Met)	APOBR (T206M)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3127987	NM_018690.4(APOBR):c.641G>A (p.Gly214Glu)	APOBR (G214E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2546255	NM_018690.4(APOBR):c.722C>G (p.Ala241Gly)	APOBR (A241G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3127989	NM_018690.4(APOBR):c.728G>A (p.Gly243Glu)	APOBR (G243E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3127990	NM_018690.4(APOBR):c.770G>T (p.Cys257Phe)	APOBR (C257F)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3127991	NM_018690.4(APOBR):c.835G>A (p.Gly279Ser)	APOBR (G279S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 752125	NM_018690.4(APOBR):c.945C>A (p.Gly315=)	APOBR	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2313869	NM_018690.4(APOBR):c.946G>A (p.Gly316Arg)	APOBR (G316R)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2459882	NM_018690.4(APOBR):c.985G>A (p.Gly329Arg)	APOBR (G329R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2517683	NM_018690.4(APOBR):c.1016T>C (p.Ile339Thr)	APOBR (I339T)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 3127979	NM_018690.4(APOBR):c.1035T>C (p.Ala345=)	APOBR	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 768769	NM_018690.4(APOBR):c.1056GGAGGCCGGGACAGCCTCAGGAGGGGA[1] (p.352EEAGTASGG[1])	APOBR	Microsatellite (inframe_deletion)	not provided	GBenign
Select item 2322780	NM_018690.4(APOBR):c.1063G>A (p.Gly355Arg)	APOBR (G355R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2646347	NM_018690.4(APOBR):c.1554C>T (p.Ala518=)	APOBR	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 3025208	NM_018690.4(APOBR):c.1732G>A (p.Glu578Lys)	APOBR (E569K +1 more)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 2512423	NM_018690.4(APOBR):c.1896G>A (p.Met632Ile)	APOBR (M623I +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2383552	NM_018690.4(APOBR):c.1933G>A (p.Glu645Lys)	APOBR (E645K +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2318008	NM_018690.4(APOBR):c.1990G>A (p.Gly664Arg)	APOBR (G655R +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2468594	NM_018690.4(APOBR):c.2188G>C (p.Ala730Pro)	APOBR (A721P +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2254123	NM_018690.4(APOBR):c.2268G>T (p.Gln756His)	APOBR (Q756H +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2471772	NM_018690.4(APOBR):c.2273G>A (p.Gly758Asp)	APOBR (G749D +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2518471	NM_018690.4(APOBR):c.2305G>A (p.Val769Met)	APOBR (V769M +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2646348	NM_018690.4(APOBR):c.2396C>T (p.Ala799Val)	APOBR (A790V +1 more)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 3127981	NM_018690.4(APOBR):c.2406G>T (p.Glu802Asp)	APOBR (E802D +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 779012	NM_018690.4(APOBR):c.2420A>C (p.Gln807Pro)	APOBR (Q807P)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 2646349	NM_018690.4(APOBR):c.2492C>T (p.Ser831Phe)	APOBR (S822F +1 more)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 2390687	NM_018690.4(APOBR):c.2974C>T (p.Leu992Phe)	APOBR (L992F +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2596628	NM_018690.4(APOBR):c.2978T>C (p.Leu993Pro)	APOBR (L984P +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2409688	NM_018690.4(APOBR):c.3164C>T (p.Pro1055Leu)	APOBR (P1055L +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3243421	NC_000016.9:g.(?_28488837)_(29001333_?)del	APOBR, ATP2A1 +15 more	Deletion	Brody myopathy	GPathogenic
Select item 3063469	GRCh37/hg19 16p11.2(chr16:28485883-29347116)x1	APOBR, ATP2A1 +15 more	Copy number loss	not specified	GPathogenic
Select item 3063422	GRCh37/hg19 16p11.2(chr16:28371467-29379768)x1	APOBR, ATP2A1 +17 more	Copy number loss	not specified	GPathogenic
Select item 3063415	GRCh37/hg19 16p11.2(chr16:28486928-29438326)x1	APOBR, ATP2A1 +15 more	Copy number loss	not specified	GPathogenic
Select item 2684799	GRCh37/hg19 16p11.2(chr16:28441539-29351827)x3	APOBR, ATP2A1 +15 more	Copy number gain	not provided	GUncertain significance
Select item 2573121	GRCh37/hg19 16p12.2-11.2(chr16:21475039-29043958)x1	NPIPB5, PALB2 +64 more	Copy number loss	Chromosome 16p12.2-p11.2 deletion syndrome	GPathogenic
Select item 2423886	NC_000016.9:g.(?_27441393)_(28899063_?)del	APOBR, ATP2A1 +18 more	Deletion	not provided	GUncertain significance
Select item 2423570	NC_000016.9:g.(?_27441393)_(29001333_?)del	APOBR, ATP2A1 +23 more	Deletion	Neuronal ceroid lipofuscinosis	GPathogenic
Select item 1809394	GRCh37/hg19 16p11.2(chr16:28371468-29342589)x3	APOBR, ATP2A1 +17 more	Copy number gain	not provided	GUncertain significance
Select item 1808864	GRCh37/hg19 16p11.2(chr16:28384464-29432245)x3	APOBR, ATP2A1 +16 more	Copy number gain	not provided	GUncertain significance
Select item 1808696	GRCh37/hg19 16p12.2-11.2(chr16:21576803-30177240)x3	ALDOA, APOBR +93 more	Copy number gain	not provided	GPathogenic
Select item 1808112	GRCh37/hg19 16p11.2(chr16:28490480-29379768)x1	APOBR, ATP2A1 +15 more	Copy number loss	not provided	GPathogenic
Select item 1807834	GRCh37/hg19 16p11.2(chr16:28486929-29351826)x1	APOBR, ATP2A1 +15 more	Copy number loss	not provided	GPathogenic
Select item 1807828	GRCh37/hg19 16p11.2(chr16:28466731-30321320)x1	ALDOA, APOBR +48 more	Copy number loss	not provided	GPathogenic
Select item 1807793	GRCh37/hg19 16p13.3-11.2(chr16:4380767-30445350)x3	ABAT, ABCC1 +226 more	Copy number gain	not provided	GPathogenic
Select item 1710520	GRCh37/hg19 16p11.2(chr16:28483659-29341550)x1	CLN3, EIF3C +15 more	Copy number loss	not provided	GPathogenic
Select item 1703567	GRCh37/hg19 16p11.2(chr16:28349949-29342589)	APOBR, ATP2A1 +17 more	Copy number loss	Distal 16p11.2 microdeletion syndrome	GPathogenic
Select item 1341176	GRCh37/hg19 16p11.2(chr16:28485883-29416001)x1	APOBR, ATP2A1 +15 more	Copy number loss	not provided	GPathogenic
Select item 1340752	GRCh37/hg19 16p11.2(chr16:28485883-29589674)x1	APOBR, ATP2A1 +18 more	Copy number loss	not provided	GPathogenic
Select item 1340300	GRCh37/hg19 16p11.2(chr16:28384465-29351826)x3	APOBR, ATP2A1 +16 more	Copy number gain	not provided	GUncertain significance
Select item 1330173	GRCh37/hg19 16p11.2(chr16:28353878-29478115)x3	EIF3C, EIF3CL +20 more	Copy number gain	Distal 16p11.2 microdeletion syndrome	GLikely pathogenic
Select item 1328113	GRCh37/hg19 16p12.2-11.2(chr16:21594997-29625302)x1	APOBR, AQP8 +67 more	Copy number loss	not provided	GPathogenic
Select item 1073956	NC_000016.9:g.(?_28488827)_(28950294_?)del	ATXN2L, APOBR +12 more	Deletion	Neuronal ceroid lipofuscinosis	GPathogenic
Select item 988931	GRCh37/hg19 16p11.2(chr16:28483631-29332591)x3	NUPR1, RABEP2 +15 more	Copy number gain	not provided	GUncertain significance
Select item 983281	GRCh37/hg19 16p13.3-11.2(chr16:2959279-30190593)x3	ABAT, ABCC1 +252 more	Copy number gain	See cases	GPathogenic
Select item 979445	GRCh37/hg19 16p11.2(chr16:28384463-29343462)x3	ATP2A1, ATXN2L +16 more	Copy number gain	not provided	GUncertain significance
Select item 979440	GRCh37/hg19 16p11.2(chr16:28488319-30178406)x1	ATXN2L, PAGR1 +44 more	Copy number loss	not provided	GPathogenic
Select item 979439	GRCh37/hg19 16p11.2(chr16:28336673-29358712)x1	CLN3, EIF3C +17 more	Copy number loss	not provided	GPathogenic
Select item 972938	GRCh37/hg19 16p12.2-11.2(chr16:21312200-29646379)x3	KDM8, LAT +69 more	Copy number gain	not provided	Gnot provided
Select item 830213	NC_000016.9:g.21530207_29332245del	KDM8, LAT +64 more	Deletion	not provided	GPathogenic
Select item 815815	GRCh37/hg19 16p11.2(chr16:28466730-30178406)x1	ZG16, QPRT +44 more	Copy number loss	not provided	GPathogenic
Select item 815811	GRCh37/hg19 16p12.2-11.2(chr16:21576802-29351826)x3	GGA2, GSG1L +64 more	Copy number gain	not provided	GPathogenic
Select item 813717	GRCh37/hg19 16p13.3-11.2(chr16:5805001-34230001)	ABAT, ABCC1 +250 more	Copy number gain	Microcephaly	GPathogenic
Select item 688970	GRCh37/hg19 16p11.2(chr16:28466730-28585574)x3	APOBR, CLN3 +3 more	Copy number gain	not provided	GUncertain significance
Select item 687737	GRCh37/hg19 16p11.2(chr16:28466730-30177916)x1	ALDOA, APOBR +44 more	Copy number loss	not provided	GPathogenic
Select item 685912	GRCh37/hg19 16p11.2(chr16:28371467-29416001)x3	APOBR, ATP2A1 +17 more	Copy number gain	not provided	GPathogenic

<< First< Prev

Page of 2