33910[HGNC] - ClinVar

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 60

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 144164	GRCh38/hg38 22q11.1-13.33(chr22:16916608-50739836)x3	IL17RA, LINC01640 +2088 more	Copy number gain	See cases	GPathogenic
Select item 145336	GRCh38/hg38 22q11.1-13.33(chr22:16916743-50739785)x3	LOC130067403, LOC130067404 +2088 more	Copy number gain	See cases	GPathogenic
Select item 57132	GRCh38/hg38 22q11.21-12.3(chr22:18178957-31821193)x3	ADORA2A, ADORA2A-AS1 +798 more	Copy number gain	See cases	GPathogenic
Select item 148861	GRCh38/hg38 22q11.21-12.3(chr22:20907226-37187347)x3	ADORA2A, ADORA2A-AS1 +823 more	Copy number gain	See cases	GPathogenic
Select item 149114	GRCh38/hg38 22q11.23-12.3(chr22:23279231-36247369)x3	LOC130067187, LOC130067188 +556 more	Copy number gain	See cases	GPathogenic
Select item 145620	GRCh38/hg38 22q11.23-12.1(chr22:25003092-28634004)x1	LOC130067151, LOC130067152 +119 more	Copy number loss	See cases	GLikely pathogenic
Select item 147324	GRCh38/hg38 22q12.1(chr22:25685148-28217405)x1	ASPHD2, CPMER +85 more	Copy number loss	See cases	GUncertain significance
Select item 59072	GRCh38/hg38 22q12.1-12.2(chr22:26221273-29477543)x1	AP1B1, ASPHD2 +122 more	Copy number loss	See cases	GPathogenic
Select item 155348	GRCh38/hg38 22q12.1-12.2(chr22:26451042-31451926)x1	AP1B1, ASCC2 +260 more	Copy number loss	See cases	GPathogenic
Select item 3170082	NM_001013694.3(SRRD):c.10G>C (p.Ala4Pro)	LOC130067147, SRRD (A4P)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3322680	NM_001013694.3(SRRD):c.29A>G (p.Glu10Gly)	LOC130067147, SRRD (E10G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2306635	NM_001013694.3(SRRD):c.36G>C (p.Trp12Cys)	LOC130067147, SRRD (W12C)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2303425	NM_001013694.3(SRRD):c.56A>G (p.Lys19Arg)	LOC130067147, SRRD (K19R)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2242327	NM_001013694.3(SRRD):c.64T>G (p.Ser22Ala)	SRRD (S22A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3170088	NM_001013694.3(SRRD):c.74G>A (p.Arg25Gln)	SRRD (R25Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2234297	NM_001013694.3(SRRD):c.82C>G (p.Arg28Gly)	LOC130067148, SRRD (R28G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 402950	NC_000022.11:g.26483998GAGAGAGGCGGCGCCCCGGGG[1]	HPS4, LOC130067148 +1 more	Microsatellite	not specified	GBenign
Select item 2385785	NM_001013694.3(SRRD):c.116C>T (p.Ala39Val)	LOC130067148, SRRD (A39V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2457097	NM_001013694.3(SRRD):c.119C>T (p.Ala40Val)	LOC130067148, SRRD (A40V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2460526	NM_001013694.3(SRRD):c.140C>T (p.Ala47Val)	LOC130067148, SRRD (A47V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3238993	NM_001013694.3(SRRD):c.150C>T (p.Gly50=)	LOC130067148, SRRD	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 3170083	NM_001013694.3(SRRD):c.151C>A (p.Pro51Thr)	LOC130067148, SRRD (P51T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2525193	NM_001013694.3(SRRD):c.173A>G (p.Asp58Gly)	SRRD (D58G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3170084	NM_001013694.3(SRRD):c.296C>A (p.Ala99Asp)	SRRD (A99D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2551964	NM_001013694.3(SRRD):c.298C>T (p.Pro100Ser)	SRRD (P100S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2544339	NM_001013694.3(SRRD):c.305G>A (p.Gly102Glu)	SRRD (G102E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2213539	NM_001013694.3(SRRD):c.342C>G (p.Asp114Glu)	SRRD (D114E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3170085	NM_001013694.3(SRRD):c.365T>C (p.Val122Ala)	SRRD (V122A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2234485	NM_001013694.3(SRRD):c.397G>A (p.Val133Ile)	SRRD (V133I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3322681	NM_001013694.3(SRRD):c.454T>G (p.Cys152Gly)	SRRD (C152G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3170086	NM_001013694.3(SRRD):c.500A>G (p.Glu167Gly)	SRRD (E167G)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2508262	NM_001013694.3(SRRD):c.607G>A (p.Glu203Lys)	SRRD (E203K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2343511	NM_001013694.3(SRRD):c.694A>C (p.Ser232Arg)	SRRD (S232R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2225464	NM_001013694.3(SRRD):c.726G>A (p.Met242Ile)	SRRD (M242I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2290595	NM_001013694.3(SRRD):c.733A>G (p.Ile245Val)	SRRD (I245V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2409221	NM_001013694.3(SRRD):c.747C>G (p.Phe249Leu)	SRRD (F249L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2569117	NM_001013694.3(SRRD):c.796C>A (p.Pro266Thr)	SRRD (P266T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2516689	NM_001013694.3(SRRD):c.803T>C (p.Ile268Thr)	SRRD (I268T)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2359610	NM_001013694.3(SRRD):c.878C>T (p.Thr293Ile)	SRRD, TFIP11 (T293I)	Single nucleotide variant (3 prime UTR variant +1 more)	not specified	GUncertain significance
Select item 3322679	NM_001013694.3(SRRD):c.925G>A (p.Asp309Asn)	SRRD, TFIP11 (D309N)	Single nucleotide variant (3 prime UTR variant +1 more)	not specified	GUncertain significance
Select item 2310283	NM_012143.4(TFIP11):c.2349G>T (p.Glu783Asp)	SRRD, TFIP11 (E752D +1 more)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2401560	NM_012143.4(TFIP11):c.2291T>C (p.Val764Ala)	SRRD, TFIP11 (V733A +1 more)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2481740	NM_012143.4(TFIP11):c.2288G>C (p.Gly763Ala)	SRRD, TFIP11 (G732A +1 more)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2303584	NM_012143.4(TFIP11):c.2248G>A (p.Glu750Lys)	SRRD, TFIP11 (E750K +1 more)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2597828	NM_012143.4(TFIP11):c.2183G>A (p.Arg728Gln)	SRRD, TFIP11 (R728Q +1 more)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2424298	NC_000022.10:g.(?_26142492)_(27026451_?)del	ASPHD2, CRYBA4 +7 more	Deletion	Cataract 23	GUncertain significance
Select item 1807757	GRCh37/hg19 22q12.1-12.2(chr22:26614429-29847680)x1	AP1B1, ASPHD2 +25 more	Copy number loss	not provided	GPathogenic
Select item 983188	GRCh37/hg19 22q11.1-13.33(chr22:16197005-51224252)x3	A4GALT, ACO2 +438 more	Copy number gain	See cases	GPathogenic
Select item 816215	GRCh37/hg19 22q12.1(chr22:26337910-28489947)x1	HPS4, MIAT +11 more	Copy number loss	not provided	GPathogenic
Select item 816197	GRCh37/hg19 22q11.1-12.1(chr22:16888899-27657507)x3	HIC2, HIRA +133 more	Copy number gain	not provided	GPathogenic
Select item 685636	GRCh37/hg19 22q11.1-13.33(chr22:16888899-51197838)x3	TUBA8, TUBGCP6 +435 more	Copy number gain	not provided	GPathogenic
Select item 565055	GRCh37/hg19 22q11.22-12.3(chr22:22460754-35198232)x3	ADORA2A, AP1B1 +129 more	Copy number gain	not provided	GPathogenic
Select item 441826	GRCh37/hg19 22q11.23-12.3(chr22:23637907-36614412)x3	ADORA2A, AP1B1 +131 more	Copy number gain	See cases	GPathogenic
Select item 441654	GRCh37/hg19 22q11.1-13.33(chr22:16888900-51197838)	ANKRD54, AP1B1 +435 more	Copy number gain	See cases	GPathogenic
Select item 441653	GRCh37/hg19 22q11.1-13.33(chr22:16888900-51197838)x3	NEFH, NF2 +435 more	Copy number gain	See cases	GPathogenic
Select item 395140	GRCh37/hg19 22q11.1-13.33(chr22:16054691-51237463)x3	ZNF280A, ZNF280B +438 more	Copy number gain	See cases	GPathogenic
Select item 394709	GRCh37/hg19 22q11.1-13.33(chr22:16054691-51220902)x3	SMARCB1, SMC1B +438 more	Copy number gain	See cases	GPathogenic
Select item 253509	GRCh37/hg19 22q11.1-13.33(chr22:16054691-51237518)x3	A4GALT, ACO2 +438 more	Copy number gain	See cases	GPathogenic
Select item 253473	GRCh37/hg19 22q11.1-12.1(chr22:16054691-27296513)x3	ADA2, ADORA2A +135 more	Copy number gain	See cases	GPathogenic
Select item 226151	GRCh37/hg19 22q12.1(chr22:26838242-26881031)	ASPHD2, SRRD +1 more	Copy number loss	Abnormal esophagus morphology	GUncertain significance

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Search results

Items: 60