10472[HGNC] - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Search results

Items: 1 to 100 of 559

<< First< Prev

Page of 6

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 155430	GRCh38/hg38 6p25.3-12.3(chr6:156974-46789291)x3	ILRUN-AS1, IP6K3 +2582 more	Copy number gain	See cases	GPathogenic
Select item 58427	GRCh38/hg38 6p21.2-21.1(chr6:37777369-45653843)x1	LOC129996415, LOC129996416 +435 more	Copy number loss	See cases	GPathogenic
Select item 58428	GRCh38/hg38 6p21.1-12.3(chr6:41638061-46512949)x1	LOC132089395, LOC132089396 +324 more	Copy number loss	See cases	GPathogenic
Select item 146275	GRCh38/hg38 6p21.1-12.3(chr6:44985760-47986838)x3	ADGRF1, ADGRF2 +78 more	Copy number gain	See cases	GLikely pathogenic
Select item 59500	GRCh38/hg38 6p21.1(chr6:44993452-46061865)x3	CLIC5, LOC109611589 +22 more	Copy number gain	See cases	GUncertain significance
Select item 357085	NM_001024630.4(RUNX2):c.-120T>C	LOC109611593, RUNX2 +1 more	Single nucleotide variant (5 prime UTR variant +2 more)	Cleidocranial dysostosis	GBenign
Select item 1196317	NM_001024630.4(RUNX2):c.-66-59A>G	LOC109611593, RUNX2 +1 more	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 357086	NM_001024630.4(RUNX2):c.-66-14G>T	LOC109611593, RUNX2 +1 more	Single nucleotide variant (intron variant)	Cleidocranial dysostosis	GBenign
Select item 1207597	NM_001024630.4(RUNX2):c.-66T>C	RUNX2, SUPT3H	Single nucleotide variant (5 prime UTR variant +2 more)	not provided	GLikely benign
Select item 357087	NM_001024630.4(RUNX2):c.-64T>C	RUNX2, SUPT3H	Single nucleotide variant (5 prime UTR variant +2 more)	Cleidocranial dysostosis	GBenign
Select item 357088	NM_001024630.4(RUNX2):c.-40C>T	RUNX2, SUPT3H	Single nucleotide variant (5 prime UTR variant +2 more)	Cleidocranial dysostosis	GUncertain significance
Select item 357089	NM_001024630.4(RUNX2):c.-11_-9del	RUNX2, SUPT3H	Deletion (5 prime UTR variant +2 more)	Cleidocranial dysostosis +1 more	GBenign/Likely benign
Select item 634442	NM_001024630.4(RUNX2):c.3G>A (p.Met1Ile)	RUNX2, SUPT3H (M1I)	Single nucleotide variant (missense variant +3 more)	not provided	GPathogenic
Select item 1942097	NM_001024630.4(RUNX2):c.14G>C (p.Ser5Thr)	RUNX2, SUPT3H (S5T)	Single nucleotide variant (missense variant +2 more)	not provided	GUncertain significance
Select item 916707	NM_001024630.4(RUNX2):c.29dup (p.Thr11fs)	RUNX2, SUPT3H (T11fs)	Duplication (frameshift variant +2 more)	Cleidocranial dysostosis	GPathogenic
Select item 3012176	NM_001024630.4(RUNX2):c.34C>T (p.Pro12Ser)	RUNX2, SUPT3H (P12S)	Single nucleotide variant (missense variant +2 more)	not provided	GUncertain significance
Select item 2598989	NM_001024630.4(RUNX2):c.43C>A (p.Gln15Lys)	RUNX2, SUPT3H (Q15K)	Single nucleotide variant (missense variant +2 more)	Inborn genetic diseases	GUncertain significance
Select item 911151	NM_001024630.4(RUNX2):c.54T>C (p.Phe18=)	RUNX2, SUPT3H	Single nucleotide variant (synonymous variant +2 more)	Cleidocranial dysostosis	GUncertain significance
Select item 1161520	NM_001024630.4(RUNX2):c.58+7G>A	RUNX2, SUPT3H	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1577874	NM_001024630.4(RUNX2):c.58+9T>C	RUNX2, SUPT3H	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 2797574	NM_001024630.4(RUNX2):c.58+18T>A	RUNX2, SUPT3H	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1277725	NM_001024630.4(RUNX2):c.58+97T>C	RUNX2, SUPT3H	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 40202	NC_000006.12:g.45341183_45446148dup	LOC109611589, LOC129996578 +2 more	Duplication	Metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome	GPathogenic
Select item 1319362	NM_003599.4(SUPT3H):c.-1+5881del	RUNX2, SUPT3H	Deletion (intron variant)	not provided	GUncertain significance
Select item 1164339	NM_001024630.4(RUNX2):c.59-1041T>C	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1266687	NM_001024630.4(RUNX2):c.59-672T>A	RUNX2	Single nucleotide variant (intron variant)	not provided	GBenign
Select item 1204787	NM_001024630.4(RUNX2):c.59-489G>A	RUNX2	Single nucleotide variant (intron variant)	not provided	GLikely benign
Select item 1196572	NM_001024630.4(RUNX2):c.59-242G>T	RUNX2	Single nucleotide variant (5 prime UTR variant +1 more)	not provided	GLikely benign
Select item 1902600	NM_001024630.4(RUNX2):c.59-10A>T	RUNX2 (I3F)	Single nucleotide variant (missense variant +1 more)	not provided	GLikely benign
Select item 1463122	NM_001024630.4(RUNX2):c.59-6C>T	RUNX2 (P4L)	Single nucleotide variant (missense variant +1 more)	not provided	GUncertain significance
Select item 2729445	NM_001024630.4(RUNX2):c.59-2A>G	RUNX2	Single nucleotide variant (synonymous variant +1 more)	not provided	GLikely pathogenic
Select item 3157204	NM_001024630.4(RUNX2):c.62C>T (p.Pro21Leu)	RUNX2 (P7L +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 2741107	NM_001024630.4(RUNX2):c.63G>C (p.Pro21=)	RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2816948	NM_001024630.4(RUNX2):c.69C>G (p.Thr23=)	RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1377457	NM_001024630.4(RUNX2):c.74G>A (p.Arg25Gln)	RUNX2 (R25Q +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1523388	NM_001024630.4(RUNX2):c.77G>C (p.Arg26Pro)	RUNX2 (R26P +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 65626	NM_001024630.4(RUNX2):c.90dup (p.Ser31fs)	RUNX2 (S17fs +1 more)	Duplication (frameshift variant)	not provided	GPathogenic
Select item 929063	NM_001024630.4(RUNX2):c.90del (p.Ser31fs)	RUNX2 (S17fs +1 more)	Deletion (frameshift variant)	Cleidocranial dysostosis	GLikely pathogenic
Select item 2056229	NM_001024630.4(RUNX2):c.85C>A (p.Pro29Thr)	RUNX2 (P29T +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2998706	NM_001024630.4(RUNX2):c.87C>T (p.Pro29=)	RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1303448	NM_001024630.4(RUNX2):c.88C>G (p.Pro30Ala)	RUNX2 (P16A +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 3315808	NM_001024630.4(RUNX2):c.89C>A (p.Pro30His)	RUNX2 (P30H +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 1933920	NM_001024630.4(RUNX2):c.97A>T (p.Ser33Cys)	RUNX2 (S19C +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2898096	NM_001024630.4(RUNX2):c.100C>G (p.Leu34Val)	RUNX2 (L20V +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1978282	NM_001024630.4(RUNX2):c.104A>T (p.Gln35Leu)	RUNX2 (Q21L +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1358664	NM_001024630.4(RUNX2):c.109G>T (p.Gly37Cys)	RUNX2 (G37C +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 911152	NM_001024630.4(RUNX2):c.124G>T (p.Val42Leu)	RUNX2 (V42L +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases +2 more	GConflicting classifications of pathogenicity
Select item 1373526	NM_001024630.4(RUNX2):c.138_175dup (p.Gln59fs)	RUNX2 (Q59fs +1 more)	Duplication (frameshift variant)	not provided	GPathogenic
Select item 1444467	NM_001024630.4(RUNX2):c.159_185dup (p.Gln63_Gln71dup)	RUNX2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 1062153	NM_001024630.4(RUNX2):c.147ACAGCAGCAGCA[1] (p.Gln68_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 497059	NM_001024630.4(RUNX2):c.159_185del (p.Gln63_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion)	not specified	GLikely benign
Select item 548496	NM_001024630.4(RUNX2):c.159ACAGCAGCAGCAGCA[3] (p.Gln67_Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	Cleidocranial dysostosis +1 more	GUncertain significance
Select item 3017746	NM_001024630.4(RUNX2):c.174_209del (p.Gln60_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2734873	NM_001024630.4(RUNX2):c.148C>T (p.Gln50Ter)	LOC109611589, RUNX2 (Q36* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 845536	NM_001024630.4(RUNX2):c.159ACAGCAGCAGCAGCA[1] (p.Gln67_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 500283	NM_001024630.4(RUNX2):c.151C>A (p.Gln51Lys)	LOC109611589, RUNX2 (Q51K +1 more)	Single nucleotide variant (missense variant)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 2189554	NM_001024630.4(RUNX2):c.153G>A (p.Gln51=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2721787	NM_001024630.4(RUNX2):c.168_194dup (p.Gln71_Glu72insGlnGlnGlnGlnGlnGlnGlnGlnGln)	LOC109611589, RUNX2	Duplication (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2179319	NM_001024630.4(RUNX2):c.159A>G (p.Gln53=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2160044	NM_001024630.4(RUNX2):c.162GCA[5] (p.Gln71_Glu72insGln)	LOC109611589, RUNX2	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 1010237	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[3] (p.Gln65_Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 2719910	NM_001024630.4(RUNX2):c.174_191del (p.Gln66_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 196302	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[1] (p.Gln65_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 1329578	NM_001024630.4(RUNX2):c.174_185dup (p.Gln68_Gln71dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	not provided	GConflicting classifications of pathogenicity
Select item 2020304	NM_001024630.4(RUNX2):c.163C>T (p.Gln55Ter)	LOC109611589, RUNX2 (Q55* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2028746	NM_001024630.4(RUNX2):c.174_179del (p.Gln70_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2572649	NM_001024630.4(RUNX2):c.173_227del (p.Gln58fs)	LOC109611589, RUNX2 (Q44fs +1 more)	Deletion (frameshift variant)	Cleidocranial dysostosis	GLikely pathogenic
Select item 2883924	NM_001024630.4(RUNX2):c.177GCA[9] (p.Gln71_Glu72insGlnGlnGln)	LOC109611589, RUNX2	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2820432	NM_001024630.4(RUNX2):c.177GCA[15] (p.Gln71_Glu72insGlnGlnGlnGlnGlnGlnGlnGlnGln)	LOC109611589, RUNX2	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 1490475	NM_001024630.4(RUNX2):c.177GCA[11] (p.Gln67_Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1192123	NM_001024630.4(RUNX2):c.177GCA[7] (p.Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GConflicting classifications of pathogenicity
Select item 1132909	NM_001024630.4(RUNX2):c.174A>G (p.Gln58=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1036921	NM_001024630.4(RUNX2):c.177GCA[8] (p.Gln70_Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 3056020	NM_001024630.4(RUNX2):c.177GCA[5] (p.Gln71del)	LOC109611589, RUNX2 (Q57del +1 more)	Microsatellite (inframe_indel)	RUNX2-related disorder	GLikely benign
Select item 1392475	NM_001024630.4(RUNX2):c.190_213del (p.Gln64_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion)	not provided	GUncertain significance
Select item 911153	NM_001024630.4(RUNX2):c.176A>G (p.Gln59Arg)	LOC109611589, RUNX2 (Q45R +1 more)	Single nucleotide variant (missense variant)	Cleidocranial dysostosis +1 more	GConflicting classifications of pathogenicity
Select item 1128357	NM_001024630.4(RUNX2):c.177G>A (p.Gln59=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1056240	NM_001024630.4(RUNX2):c.195_209dup (p.Gln67_Gln71dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 1456832	NM_001024630.4(RUNX2):c.184C>T (p.Gln62Ter)	LOC109611589, RUNX2 (Q62* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2754949	NM_001024630.4(RUNX2):c.186G>A (p.Gln62=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2089848	NM_001024630.4(RUNX2):c.187C>T (p.Gln63Ter)	LOC109611589, RUNX2 (Q49* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 9295	NM_001024630.4(RUNX2):c.189_203delinsACAGCAGCAGCAGCAGCAGCAACAGCAGCCG (p.Glu72fs)	LOC109611589, RUNX2 (E72fs +1 more)	Indel (frameshift variant)	Cleidocranial dysostosis	GPathogenic
Select item 2136397	NM_001024630.4(RUNX2):c.190C>T (p.Gln64Ter)	LOC109611589, RUNX2 (Q50* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2074477	NM_001024630.4(RUNX2):c.191A>G (p.Gln64Arg)	LOC109611589, RUNX2 (Q50R +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2706950	NM_001024630.4(RUNX2):c.194_286del (p.Gln65_Pro95del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2189575	NM_001024630.4(RUNX2):c.193_231del (p.Gln65_Ala77del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 1429046	NM_001024630.4(RUNX2):c.196CAG[7] (p.Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1121355	NM_001024630.4(RUNX2):c.195A>G (p.Gln65=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 2769121	NM_001024630.4(RUNX2):c.196CAG[4] (p.Gln70_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2734874	NM_001024630.4(RUNX2):c.196C>T (p.Gln66Ter)	LOC109611589, RUNX2 (Q66* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2734875	NM_001024630.4(RUNX2):c.199C>T (p.Gln67Ter)	LOC109611589, RUNX2 (Q53* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 1022116	NM_001024630.4(RUNX2):c.199_200del (p.Gln67fs)	LOC109611589, RUNX2 (Q53fs +1 more)	Deletion (frameshift variant)	not provided	GUncertain significance
Select item 1338512	NM_001024630.4(RUNX2):c.200_201insACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAG (p.Glu72fs)	LOC109611589, RUNX2 (E58fs +1 more)	Insertion (frameshift variant)	not provided	GPathogenic
Select item 1337138	NM_001024630.4(RUNX2):c.201G>A (p.Gln67=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 916702	NM_001024630.4(RUNX2):c.203delinsCG (p.Gln68fs)	LOC109611589, RUNX2 (Q54fs +1 more)	Indel (frameshift variant)	Cleidocranial dysostosis	GLikely pathogenic
Select item 2859807	NM_001024630.4(RUNX2):c.205C>T (p.Gln69Ter)	LOC109611589, RUNX2 (Q55* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2988054	NM_001024630.4(RUNX2):c.210G>T (p.Gln70His)	LOC109611589, RUNX2 (Q56H +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1534081	NM_001024630.4(RUNX2):c.210G>A (p.Gln70=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2903269	NM_001024630.4(RUNX2):c.212AGG[3] (p.Glu72_Ala73insGlu)	LOC109611589, RUNX2	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 976311	NM_001024630.4(RUNX2):c.211C>T (p.Gln71Ter)	LOC109611589, RUNX2 (Q57* +1 more)	Single nucleotide variant (nonsense)	not provided +1 more	GLikely pathogenic

<< First< Prev

Page of 6