this is a pathogenic variant associated with Noonan Syndrome
ClinVar Genomic variation as it relates to human health
NM_012250.6(RRAS2):c.70_78dup (p.Gly24_Gly26dup)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(9)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
9
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_012250.6(RRAS2):c.70_78dup (p.Gly24_Gly26dup)
Variation ID: 626913 Accession: VCV000626913.15
- Type and length
-
Duplication, 9 bp
- Location
-
Cytogenetic: 11p15.2 11: 14358792-14358793 (GRCh38) [ NCBI UCSC ] 11: 14380338-14380339 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Oct 12, 2019 Jul 23, 2024 Sep 5, 2023 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_012250.6:c.70_78dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_036382.2:p.Gly24_Gly26dup inframe insertion NM_001177314.2:c.3+5590_3+5598dup intron variant NM_012250.5:c.70_78dup NM_012250.5:c.70_78dupGGCGTGGGC NC_000011.10:g.14358797_14358805dup NC_000011.9:g.14380343_14380351dup NG_017058.1:g.10706_10714dup - Protein change
- -
- Other names
-
p.Gly24_Gly26dup
- Canonical SPDI
- NC_000011.10:14358792:GCCCACGCCGCCC:GCCCACGCCGCCCACGCCGCCC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| LOC130005368 | - | - | - | GRCh38 | - | 15 |
| RRAS2 | - | - |
GRCh38 GRCh37 |
61 | 88 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (1) |
criteria provided, single submitter
|
Apr 1, 2019 | RCV000852399.2 | |
| Pathogenic (6) |
criteria provided, multiple submitters, no conflicts
|
Jul 17, 2023 | RCV000853184.6 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Sep 13, 2019 | RCV001265738.2 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Sep 5, 2023 | RCV003117554.5 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Apr 01, 2019)
|
criteria provided, single submitter
Method: research
|
Noonan Syndrome
Affected status: yes
Allele origin:
de novo
|
Tartaglia Lab, Genetics and Rare Diseases Research Division, Bambino Gesu' Children's Hospital
Accession: SCV000902253.1
First in ClinVar: Oct 12, 2019 Last updated: Oct 12, 2019 |
Comment:
this is a pathogenic variant associated with Noonan Syndrome
|
|
|
Pathogenic
(Feb 19, 2021)
|
criteria provided, single submitter
Method: research
|
Noonan syndrome 12
Affected status: yes
Allele origin:
de novo
|
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology
Study: CSER-SouthSeq
Accession: SCV001482523.1 First in ClinVar: Mar 07, 2021 Last updated: Mar 07, 2021 |
Comment:
ACMG codes:PS2, PS3, PS4M, PM1, PM2, PM4, PP5
Number of individuals with the variant: 1
Clinical Features:
Abnormality of the outer ear (present) , Micrognathia (present) , Abnormality of the face (present) , Polyhydramnios (present) , Ventricular septal defect (present) , Hypotonia … (more)
Abnormality of the outer ear (present) , Micrognathia (present) , Abnormality of the face (present) , Polyhydramnios (present) , Ventricular septal defect (present) , Hypotonia (present) , Femur fracture (present) , Ventricular septal defect (present) , Congenital laryngomalacia (present) , Rib fusion (present) , Nasolacrimal duct obstruction (present) (less)
|
|
|
Pathogenic
(Jul 09, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Noonan Syndrome 12
Affected status: yes
Allele origin:
germline
|
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego
Accession: SCV001984843.1
First in ClinVar: Oct 30, 2021 Last updated: Oct 30, 2021 |
Comment:
This variant has been previously reported as a de novo heterozygous change in two patients with Noonan Syndrome (PMID: 31130285, 31130282). The c.70_78dup (p.Gly24_Gly26dup) variant … (more)
This variant has been previously reported as a de novo heterozygous change in two patients with Noonan Syndrome (PMID: 31130285, 31130282). The c.70_78dup (p.Gly24_Gly26dup) variant maps to a phosphate binding loop (P loop) in a domain that is conserved across the RAS family and affects the well-established mutational hotspot of RAS proteins. Functional studies of the p.Gly24_Gly26dup variant demonstrate that it has a gain-of-function effect by increasing affinity for RAF and activating MEK/ERK pathway (PMID: 11850823, 31130285, 31130282). In-vivo studies found that larvae harboring this variant had craniofacial defects and macrocephaly (PMID: 31130285). It is absent from the gnomAD population database and thus is presumed to be rare. In silico analyses support a deleterious effect of the c.70_78dup (p.Gly24_Gly26dup) variant on protein function. Analysis of the parental samples was negative for the variant through external send-out testing, indicating this variant likely occurred as a de novo event. Based on the available evidence, the c.70_78dup (p.Gly24_Gly26dup) variant is classified as Pathogenic. (less)
|
|
|
Pathogenic
(Sep 13, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Inborn genetic diseases
Affected status: yes
Allele origin:
germline
|
Ambry Genetics
Accession: SCV001443907.2
First in ClinVar: Nov 21, 2020 Last updated: Jan 07, 2023 |
Observation 1:
Number of individuals with the variant: 1
Clinical Features:
Neurodevelopmental delay (present) , Hypoplastic left heart syndrome (present) , Stroke (present) , Ketotic hypoglycemia (present) , Seizures (present) , Severe combined immunodeficiency disease (present) … (more)
Neurodevelopmental delay (present) , Hypoplastic left heart syndrome (present) , Stroke (present) , Ketotic hypoglycemia (present) , Seizures (present) , Severe combined immunodeficiency disease (present) , Recurrent infections (present) , Strabismus (present) , Hypercoagulability (present) , Chronic lung disease (present) , Constipation (present) , Gastroesophageal reflux (present) , Hepatic fibrosis (present) (less)
Sex: female
Ethnicity/Population group: Caucasian
Observation 2:
Number of individuals with the variant: 1
Clinical Features:
Failure to thrive (present) , Feeding difficulties in infancy (present) , Bilateral sensorineural hearing impairment (present) , Abnormality of cochlea (present) , Hypoplasia of the … (more)
Failure to thrive (present) , Feeding difficulties in infancy (present) , Bilateral sensorineural hearing impairment (present) , Abnormality of cochlea (present) , Hypoplasia of the semicircular canal (present) , Plagiocephaly (present) , Hypertelorism (present) , Wide nasal bridge (present) , Low-set ears (present) , Prominent forehead (present) , Wide intermamillary distance (present) , Broad ribs (present) , Beaking of vertebral bodies (present) , Neurodevelopmental delay (present) , Muscular hypotonia (present) , Gastroesophageal reflux (present) , Torticollis (present) , Hydrocephalus (present) (less)
Sex: female
Ethnicity/Population group: Asian
|
|
|
Pathogenic
(Apr 10, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Noonan syndrome 12
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004041214.1
First in ClinVar: Oct 07, 2023 Last updated: Oct 07, 2023 |
|
|
|
Pathogenic
(Sep 05, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV003786516.3
First in ClinVar: Feb 13, 2023 Last updated: Feb 20, 2024 |
Comment:
This variant, c.70_78dup, results in the insertion of 3 amino acid(s) of the RRAS2 protein (p.Gly24_Gly26dup), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.70_78dup, results in the insertion of 3 amino acid(s) of the RRAS2 protein (p.Gly24_Gly26dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of Noonan or cardiofaciocutaneous syndrome (PMID: 31130282, 31130285). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 626913). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects RRAS2 function (PMID: 31130285). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
|
Pathogenic
(Jul 17, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Noonan syndrome 12
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline
|
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute
Additional submitter:
Shariant Australia, Australian Genomics
Accession: SCV005086658.1
First in ClinVar: Jul 23, 2024 Last updated: Jul 23, 2024 |
Comment:
Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0101 - Gain of function is a known mechanism … (more)
Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0101 - Gain of function is a known mechanism of disease in this gene and is associated with Noonan syndrome 12 (MIM#618624) (PMIDs: 31130282, 31130285). (I) 0107 - This gene is associated with autosomal dominant disease. (I) 0213 - In-frame insertion/deletion in a non-repetitive region that has uninformative conservation. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0603 - Missense variant in a region that is highly intolerant to missense variation (high constraint region in DECIPHER). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant has been reported as pathogenic, and observed as de novo in at least three individuals with Noonan syndrome and macrocephaly (ClinVar, PMID: 31130282, PMID: 31130285). (SP) 1002 - This variant has moderate functional evidence supporting abnormal protein function. This variant has been functionally proven to increase association with RAF1, and activate ERK1/2 and ELK1 (PMID: 31130285). (SP) 1205 - This variant has been shown to be maternally inherited (19W000224). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign (less)
|
|
|
Pathogenic
(Oct 15, 2019)
|
no assertion criteria provided
Method: literature only
|
NOONAN SYNDROME 12
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000995988.1
First in ClinVar: Oct 20, 2019 Last updated: Oct 20, 2019 |
Comment on evidence:
In a 22-month-old male infant of South American and Ashkenazi ancestry (patient 6) with Noonan syndrome (NS12; 618624), Capri et al. (2019) identified heterozygosity for … (more)
In a 22-month-old male infant of South American and Ashkenazi ancestry (patient 6) with Noonan syndrome (NS12; 618624), Capri et al. (2019) identified heterozygosity for a de novo 9-bp duplication (c.70_78dup, NM_012250.5) in the RRAS2 gene, resulting in an in-frame duplication (Gly24_Gly26dup) within the phosphate-binding loop. In a 6-year-old girl with Noonan syndrome (patient NS462), Niihori et al. (2019) identified heterozygosity for the c.70_78 duplication (c.70_78dup, NM_012250.6) in the RRAS2 gene, which was shown to have arisen de novo and was confirmed in hair and fingernails, consistent with a germline mutation. The authors noted that the duplication previously had been identified in a human uterine leiomyosarcoma cell line (SK-UT-1). Zebrafish larvae expressing the 9-bp duplication showed reduced body length, greater relative head length, and increased ceratohyal angle compared to wildtype larvae. (less)
|
|
|
Pathogenic
(Oct 25, 2023)
|
no assertion criteria provided
Method: clinical testing
|
Noonan syndrome 12
Affected status: yes
Allele origin:
de novo
|
Undiagnosed Diseases Network, NIH
Study: Undiagnosed Diseases Network (NIH), UDN
Accession: SCV004242189.1 First in ClinVar: Feb 04, 2024 Last updated: Feb 04, 2024 |
Number of individuals with the variant: 1
Clinical Features:
Premature birth (present) , Hypertelorism (present) , Micrognathia (present) , Low-set, posteriorly rotated ears (present) , Downslanted palpebral fissures (present) , Global developmental delay (present) … (more)
Premature birth (present) , Hypertelorism (present) , Micrognathia (present) , Low-set, posteriorly rotated ears (present) , Downslanted palpebral fissures (present) , Global developmental delay (present) , Stroke disorder (present) , Hepatic fibrosis (present) , Premature birth (present) , Ventricular septal defect (present) , Atrial septal defect (present) , Subvalvular aortic stenosis (present) , Lymphopenia (present) , Fever (present) , Abnormal facial shape (present) , Pulmonary embolism (present) , Increased circulating ferritin concentration (present) , Venous thrombosis (present) , Juvenile rheumatoid arthritis (present) , Chronic lung disease (present) , Chylothorax (present) , Thick vermilion border (present) , Ketotic hypoglycemia (present) , Systemic autoinflammation (present) , Congenital malformation of the left heart (present) , Decreased specific antibody response to protein vaccine (present) , Decreased specific antibody response to polysaccharide vaccine (present) (less)
Age: 0-9 years
Sex: female
Tissue: Blood
Testing laboratory: Baylor Genetics
|
Comment:
Comment:
ACMG codes:PS2, PS3, PS4M, PM1, PM2, PM4, PP5
Comment:
This variant has been previously reported as a de novo heterozygous change in two patients with Noonan Syndrome (PMID: 31130285, 31130282). The c.70_78dup (p.Gly24_Gly26dup) variant maps to a phosphate binding loop (P loop) in a domain that is conserved across the RAS family and affects the well-established mutational hotspot of RAS proteins. Functional studies of the p.Gly24_Gly26dup variant demonstrate that it has a gain-of-function effect by increasing affinity for RAF and activating MEK/ERK pathway (PMID: 11850823, 31130285, 31130282). In-vivo studies found that larvae harboring this variant had craniofacial defects and macrocephaly (PMID: 31130285). It is absent from the gnomAD population database and thus is presumed to be rare. In silico analyses support a deleterious effect of the c.70_78dup (p.Gly24_Gly26dup) variant on protein function. Analysis of the parental samples was negative for the variant through external send-out testing, indicating this variant likely occurred as a de novo event. Based on the available evidence, the c.70_78dup (p.Gly24_Gly26dup) variant is classified as Pathogenic.
Comment:
This variant, c.70_78dup, results in the insertion of 3 amino acid(s) of the RRAS2 protein (p.Gly24_Gly26dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of Noonan or cardiofaciocutaneous syndrome (PMID: 31130282, 31130285). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 626913). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects RRAS2 function (PMID: 31130285). For these reasons, this variant has been classified as Pathogenic.
Comment:
Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0101 - Gain of function is a known mechanism of disease in this gene and is associated with Noonan syndrome 12 (MIM#618624) (PMIDs: 31130282, 31130285). (I) 0107 - This gene is associated with autosomal dominant disease. (I) 0213 - In-frame insertion/deletion in a non-repetitive region that has uninformative conservation. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0603 - Missense variant in a region that is highly intolerant to missense variation (high constraint region in DECIPHER). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant has been reported as pathogenic, and observed as de novo in at least three individuals with Noonan syndrome and macrocephaly (ClinVar, PMID: 31130282, PMID: 31130285). (SP) 1002 - This variant has moderate functional evidence supporting abnormal protein function. This variant has been functionally proven to increase association with RAF1, and activate ERK1/2 and ELK1 (PMID: 31130285). (SP) 1205 - This variant has been shown to be maternally inherited (19W000224). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
this is a pathogenic variant associated with Noonan Syndrome
Comment:
ACMG codes:PS2, PS3, PS4M, PM1, PM2, PM4, PP5
Comment:
This variant has been previously reported as a de novo heterozygous change in two patients with Noonan Syndrome (PMID: 31130285, 31130282). The c.70_78dup (p.Gly24_Gly26dup) variant maps to a phosphate binding loop (P loop) in a domain that is conserved across the RAS family and affects the well-established mutational hotspot of RAS proteins. Functional studies of the p.Gly24_Gly26dup variant demonstrate that it has a gain-of-function effect by increasing affinity for RAF and activating MEK/ERK pathway (PMID: 11850823, 31130285, 31130282). In-vivo studies found that larvae harboring this variant had craniofacial defects and macrocephaly (PMID: 31130285). It is absent from the gnomAD population database and thus is presumed to be rare. In silico analyses support a deleterious effect of the c.70_78dup (p.Gly24_Gly26dup) variant on protein function. Analysis of the parental samples was negative for the variant through external send-out testing, indicating this variant likely occurred as a de novo event. Based on the available evidence, the c.70_78dup (p.Gly24_Gly26dup) variant is classified as Pathogenic.
Comment:
This variant, c.70_78dup, results in the insertion of 3 amino acid(s) of the RRAS2 protein (p.Gly24_Gly26dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of Noonan or cardiofaciocutaneous syndrome (PMID: 31130282, 31130285). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 626913). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects RRAS2 function (PMID: 31130285). For these reasons, this variant has been classified as Pathogenic.
Comment:
Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0101 - Gain of function is a known mechanism of disease in this gene and is associated with Noonan syndrome 12 (MIM#618624) (PMIDs: 31130282, 31130285). (I) 0107 - This gene is associated with autosomal dominant disease. (I) 0213 - In-frame insertion/deletion in a non-repetitive region that has uninformative conservation. (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0603 - Missense variant in a region that is highly intolerant to missense variation (high constraint region in DECIPHER). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant has been reported as pathogenic, and observed as de novo in at least three individuals with Noonan syndrome and macrocephaly (ClinVar, PMID: 31130282, PMID: 31130285). (SP) 1002 - This variant has moderate functional evidence supporting abnormal protein function. This variant has been functionally proven to increase association with RAF1, and activate ERK1/2 and ELK1 (PMID: 31130285). (SP) 1205 - This variant has been shown to be maternally inherited (19W000224). (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign
Citations for germline classification of this variant
HelpText-mined citations for rs1591495767 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.