5T7B: Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex

PDB ID: 5T7BDownload
MMDB ID: 145678
PDB Deposition Date: 2016/9/2
Updated in MMDB: 2016/12
Experimental Method:
x-ray diffraction
Resolution: 2.529  Å
Source Organism:
Mus musculus▼
Similar Structures:
Biological Unit for 5T7B: dimeric; determined by author and by software (PISA)
Molecular Components in 5T7B
Label Count Molecule
Protein (1 molecule)
1
Protein Argonaute-2
Molecule annotation
Nucleotide(1 molecule)
1
RNA (Uvp)uauagagcaagaacacuguu
Molecule annotation
Chemicals and Non-standard biopolymers (2 molecules)
1
2
PHENOLPHENOL
* Click molecule labels to explore molecular sequence information.
Citing MMDB
Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A, Bryant SH. " MMDB and VAST+: tracking structural similarities between macromolecular complexes. Nucleic Acids Res. 2014 Jan; 42(Database issue):D297-303