|
| Status |
Public on Nov 20, 2013 |
| Title |
POR |
| Sample type |
SRA |
| |
|
| Source name |
EBV transformed mononuclear cells from peripheral blood
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: Lymphoblastoid cells
control lymphoblastoid cell line id: WT:GM07006
wbs lymphoblastoid cell line id: WBS:GM13472
interrogated locus: POR
|
| Biomaterial provider |
Coriell; http://ccr.coriell.org/Sections/Search/Search.aspx?PgId=165&q=GM07006
Coriell; http://ccr.coriell.org/Sections/Search/Search.aspx?PgId=165&q=GM13472
|
| Growth protocol |
Lymphoblastoid cell lines were grown in RPMI1640 medium supplemented with 10% FCS and 1% PS
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
50 million exponentially growing cells were harvested and crosslinked with 1% formaldehyde, lysed and cut with the restriction enzyme BglII. After ligation and reversal of the crosslinks, the DNA was purified to obtain the 3C library. This 3C library was further digested with NlaIII and circularized to obtain a 4C library. The inverse PCR primers to make the 4C-seq templates were designed to contain the Illumina adaptor tails, as well as the bait-specific sequences for each of the six loci we interrogated. 4C libraries were multiplexed (three samples per mulitplex), libraries were prepared according to Illumina's instructions for ChIP-seq but without size selection and sequenced on Illumina GAIIxl (76-mer single end tags)
Instrument model: Illumina GAIIxl
library_strategy: 4C-seq
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
Primer name: POR_4C_seq_F
Sequence: AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTCTCTTCCCCTCCCTACCAC
Primer name: POR_4C_seq_R
Sequence: CAAGCAGAAGACGGCATACGATACGTAAGGAACGCGTCCAA
|
| Data processing |
Reads were normalized to the total number of reads. Smoothed data were obtained by applying a running mean algorithm with 19 fragments per window.As the data from the three replicated viewpoints were strongly correlated, we used the average of each fragments for these experiments.
We used a domainogram algorithm to detect significantly interacting regions without imposing a fixed window size as suggested in [de Wit et al, Global chromatin domain organization of the Drosophila genome, PLoS Genet. 2008 Mar 28;4(3)]. The positive signals were ranked per chromosome and Bricks (Blocks of Regulators In Chromosomal Kontext) were called based on a FDR threshold of 0.1 for “short-range” interactions, defined as interactions within 2.5 Mb up- and downstream of GBAS and MDH2, the first and last viewpoint, respectively (HSA7 coordinates: 53,532,296-78,116,172; about 25 Mb around the WBSCR). Genomic space outside of these borders was called the “long-range” region. As interactions in this long-range region are more subject to random interactions, we used a more stringent FDR threshold of 0.001. To determine differentially interacting regions between the WBS and Ctrl cells, we first computed the log2 ratio of WBS over Ctrl of the smoothed profile corrected data and selected ratio Bricks (as described above) that were specific to either WBS or Ctrl.
Genome_build: hg19
Supplementary_files_format_and_content: bedGraph files: The 2 "smoothed" files correspond to smoothed data for 2 conditions (WT and WBS), while file "ratios_selectedBricks.bedGraph" is a list of significantly interacting regions obtained as described above.
|
| |
|
| Submission date |
Nov 22, 2011 |
| Last update date |
Nov 20, 2013 |
| Contact name |
Marion LELEU |
| E-mail(s) |
marion.leleu@epfl.ch
|
| Phone |
+41 (0)21 693 18 32
|
| Organization name |
EPFL
|
| Street address |
Station 15
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL10999 |
| Series (1) |
| GSE33867 |
Structural variation-induced changes of chromatin architecture and gene expression |
|
| Relations |
| BioSample |
SAMN02050076 |
