|
| Status |
Public on Dec 12, 2011 |
| Title |
Stage32_1 |
| Sample type |
SRA |
| |
|
| Source name |
Retinas from stage 32 embryos
|
| Organism |
Xenopus laevis |
| Characteristics |
tissue: retinas
Stage: 32
|
| Treatment protocol |
N/A
|
| Growth protocol |
Xenopus laevis embyros were grown in 0.1X Modified Bath’s Saline at 14-22 oC until stage 24, 32 or 40
|
| Extracted molecule |
total RNA |
| Extraction protocol |
A tolal of 100 eyes were extracted from stage 24, 32 and 40 Xenopus laevis embryos, anesthesized in 1.5 mM MS222 (3-aminobenzoic acid ethyl ester methanesulphonate salt). Developing lenses were dissected out, to obtain eyes composed of the neural retina and retinal pigmented epithelium and placed in RNA later. Total RNA was subsequently extracted using standard Trizol protocol for small sample size.
Small RNAs were extracted from denaturing PAGE and a 3' adapter was ligated to the end of each RNA molecule. 5' dependent libraries were generated using the Illumina/Solexa IG sequencing instrument.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
3' adapter sequence: ATCTCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Fastq data files were processed using custom Perl scripts. Reads with missing bases were excluded. 3' adapter sequences were identified and removed based on at least six matching nucleotides, allowing for up to two mismatches. Trimmed reads shorter than 16 nucleotides were discarded, along with reads without recognizable adapter sequences. The resulting 16-30 nt inserts were aligned to the X. tropicalis genome (xenTro2) downloaded from the UCSC Genome Browser website (http://genome.ucsc.edu/) using the ELAND module within the Illumina Genome Analyzer Pipeline Software, v0.3.0. Only perfect alignments were considered. In the case of reads aligning to multiple locations, the read-depth was scaled by the number of possible alignments. Read counts for mature miRNAs were obtained by assigning each miRNA the total number of reads (normalized for multiple alignments) overlapping the genomic locus of the mature miRNA (miRBase release 16).
FASTA (.fa) file contains unique sequences after trimming, the total count of each unique sequence is added to the end of the identifier line.
miRNA_mapped_counts.txt: Contains the counts of reads mapped to miRNA loci. Each sample is represented by one column. The first row contains the total read count that was used for mapping purposes, for each library.
|
| |
|
| Submission date |
Nov 03, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Cei Abreu-Goodger |
| E-mail(s) |
cei.abreu@cinvestav.mx
|
| Organization name |
Langebio - Cinvestav
|
| Street address |
Km. 9.6 Libramiento Nte Carr Leon-Irapuato
|
| City |
Irapuato |
| State/province |
Guanajuato |
| ZIP/Postal code |
36824 |
| Country |
Mexico |
| |
|
| Platform ID |
GPL14834 |
| Series (1) |
| GSE33444 |
miR-124 acts through coREST to control the onset of Sema3A sensitivity in navigating retinal growth cones |
|
| Relations |
| SRA |
SRX104185 |
| BioSample |
SAMN00749955 |
