|
Status |
Public on Jul 10, 2009 |
Title |
Tomato yellow leaf curl virus (TYLCV) derived small RNAs |
Sample type |
SRA |
|
|
Source name |
Leaves from Solanum lycopersicum infected with TYLCV
|
Organism |
Tomato yellow leaf curl virus |
Characteristics |
tissue: upper noninoculated systemically infected leaves from Solanum lycopersicum virus: TYLCV
|
Treatment protocol |
Plants were infected by mechanical inoculation
|
Growth protocol |
Plants were grown under standard conditions
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted using Trizol reagent and ~300 microgrames were used for construction of sRNAs libraries. The 3’ adapter was a pre-activated 5’ adenylated oligo (5’ rAppCTGTAGGCACCATCAAT3ddC 3’) to avoid the circularization of sRNAs. The 5' adpaters were chimeric RNA/DNA oligonucleotide generated by modification of the four-nucleotide identifier. After each ligation step, sRNA was purified using 17 % denaturing PAGE. The purified-ligated sRNA was reverse transcribed and the cDNA was amplified using Taq DNA polymerase and 3’ PCR FusionB and 5’ PCR FusionA primers. PCR primers contained the “A” and “B” tag sequences used by 454 Life Science during sequencing. DNA amplicons were gel-purified using 12 % native polyacrylamide and eluted in 0.3M NaCl. Quantity and quality of DNA amplicons were measured using ND-1000 spectrophotometer (Nanodrop) and Experion Automated Electrophoresis System (BioRad), respectively. Same quantity of DNA amplicon from each library was pooled and sequenced by 454 Life Science technology (Lifesequencing, http://lifesequencing.com).
|
|
|
Library strategy |
OTHER |
Library source |
viral RNA |
Library selection |
RT-PCR |
Instrument model |
454 GS FLX |
|
|
Description |
Virus: TYLCV Genus: Begomovirus Genome type: ssDNA circular barcode: CGCA 5' ADAPTOR: GCCTCCCTCGCGCCATCAGATCGTAGCGCACTGATA accesion number for virus isolate used: (NC_004005) processed file: smallRNA hit name - number after the virus name indicates how many times sRNA sequence was recovered.
|
Data processing |
sRNA sequences were parsed from FASTA formatted files and assigned to specific libraries through identification of the sRNA/adapter boundaries and barcode analysis. The adapter sequences in the 454 sequencing reads were removed by using python scripts and the biopython library (http://biopython.org/). The viral genomic sequences were downloaded from NCBI (http://www.ncbi.hlm.nih.gov). vsRNA reads were mapped to the viral genomic sequences by using Blast and Vmatch (http://www.vmatch.de/)
|
|
|
Submission date |
Jul 08, 2009 |
Last update date |
Jun 11, 2013 |
Contact name |
Yu Wang |
E-mail(s) |
yu.1.wang@googlemail.com
|
Organization name |
Leibniz Supercomputing Centre
|
Department |
High performance computing
|
Lab |
Big Data for Life Science
|
Street address |
Boltzmannstrasse 1
|
City |
Garchinig |
ZIP/Postal code |
85748 |
Country |
Germany |
|
|
Platform ID |
GPL9376 |
Series (1) |
GSE16996 |
High-throughput pyrosequencing of plant virus small RNAs |
|
Relations |
BioSample |
SAMN02196671 |