U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX3176769: GSM2779426: Control at 5 days, replication 2 [CT_5D_REP2_AGTTCC]; Gallus gallus; RNA-Seq
2 ILLUMINA (Illumina HiSeq 1500) runs: 21.7M spots, 2.2G bases, 890Mb downloads

Submitted by: NCBI (GEO)
Study: Effect of Nicotine on neural tube development
show Abstracthide Abstract
Neural tube defects (NTD) occur in 3000 births per year in the US. Several risk factors have been proposed for NTDs including both first hand and passive smoking during the periconceptual period. Previously we reported an increased frequency of cervical region NTD in a chicken model of prenatal nicotine exposure (Bohn, Humphrey et al. 2014; Humprey, Bohn et al. 2014). Here, we will reveal the mechanisms of the insult. The specific aims include: 1) Evaluation of the gene expression changes in the chicken model of nicotine exposure that we developed previosly. Such genome-wide analysis of the expression allows to collect very detailed data regarding the drug impact. To our knowlidge, comparable analysis of nicotine induced changes in gene expression during development of any species has never been conducted. 2) Evaluation of nicotine induced alterations in tadpoles (Xenopus tropica). The frogs will be treated in a manner similar to chicken (the same drug doses and a matched time of sacrifice) and analyzed both histologically and for gene expression. Incorporation of a different group of vertebrates in this study is essential for dissecting the evolutionary conserved role this pathway of interest in development which is another strong aspect of this proposal. We believe, that our comparative approach will allow more effective extrapolation of data from animal models to humans and better understanding of the evolutionary process. Nicotine is one of the most common developmental insults in humans. The consequences of this exposure are well-documented. However, the affected pathways are unknown. The identification of the mechanisms of nicotine induced alterations proposed here is vital for development of better treatment strategies. Overall design: There are 2 variables, Nicotine treatment (Nicotine treated and control) and days of incubation (5 days and 7 days). For each treatment 4 biological replicates were used.
Sample: Control at 5 days, rep 2 [CT_5D_REP2_AGTTCC]
SAMN07629652 • SRS2506464 • All experiments • All runs
Organism: Gallus gallus
Library:
Instrument: Illumina HiSeq 1500
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: PAIRED
Construction protocol: At the time point of sacrifice (5 or 7 days), egg shells were chipped off and the animals’ viability and proper development was verified. The verification of viability was based on observation of a heartbeat. Appropriate development and lack of gross abnormalities in animals were also verified (Hamburger and Hamilton 1951). Embryos (randomly selected 4 biological replicates for each treatment and time point) were harvested in RNAse- free conditions and dissected in cold DEPC-treated PBS. The section between the mid portion of the neck and posterior border of the anterior limb was cut out. A part of this section containing spinal cord was dissected using fine scissors, tweezers, and glass needles and then placed into a 1.5 ml tube filled with ice-cold DEPC-treated PBS. The samples were homogenized in TRI Reagent® or Trizol®(Sigma) and RNA extraction was completed using Ambion® PureLink® RNA Mini Kit (all reagents were obtained from Sigma-Aldrich (St. Louis, Missouri, USA)). All RNA samples were stored at -80 °C before being shipped to Marshall University Genomics and Bioinformatics Core (GABC) where the expression analysis was conducted. The RNA samples were sequenced (2 x 50 Paired End sequencing, 25 million reads per library) at Marshall University, WV, genomics core facility Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,,,,,,, AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT,,,,,,,
Experiment attributes:
GEO Accession: GSM2779426
Links:
Runs: 2 runs, 21.7M spots, 2.2G bases, 890Mb
Run# of Spots# of BasesSizePublished
SRR602629711,261,8961.1G463.6Mb2020-09-11
SRR602629810,449,7171.1G426.4Mb2020-09-11

ID:
4478620

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...