Instrument: Illumina HiSeq 1500
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: PAIRED
Construction protocol: At the time point of sacrifice (5 or 7 days), egg shells were chipped off and the animals’ viability and proper development was verified. The verification of viability was based on observation of a heartbeat. Appropriate development and lack of gross abnormalities in animals were also verified (Hamburger and Hamilton 1951). Embryos (randomly selected 4 biological replicates for each treatment and time point) were harvested in RNAse- free conditions and dissected in cold DEPC-treated PBS. The section between the mid portion of the neck and posterior border of the anterior limb was cut out. A part of this section containing spinal cord was dissected using fine scissors, tweezers, and glass needles and then placed into a 1.5 ml tube filled with ice-cold DEPC-treated PBS. The samples were homogenized in TRI Reagent® or Trizol®(Sigma) and RNA extraction was completed using Ambion® PureLink® RNA Mini Kit (all reagents were obtained from Sigma-Aldrich (St. Louis, Missouri, USA)). All RNA samples were stored at -80 °C before being shipped to Marshall University Genomics and Bioinformatics Core (GABC) where the expression analysis was conducted. The RNA samples were sequenced (2 x 50 Paired End sequencing, 25 million reads per library) at Marshall University, WV, genomics core facility Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,,,,,,, AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT,,,,,,,