Instrument: Illumina NovaSeq 6000
Strategy: OTHER
Source: OTHER
Selection: other
Layout: PAIRED
Construction protocol: To prepare half R-loop substrates, RNA (5'-GGGAUGGUGCUGGACUCAUUCGGCAUCGGCGCUACAGAAGAUGCAGAACGCUUUGGUGACGUCGGGGCUGACACCCUGGGUCAUAUCGCAGAAGCUUGUGCCAAAGGCGAAGCUGAUAACGGUCGUAAAGGCCCGCUCAAUCUGCCAAAUCUGACCCGUCUGGGGCUGGCGAAAGCACACGAAGGUUCUACCGGUUUCAUUCC-3') was produced by using in vitro transcription kit (New England Biolabs; M0658) and purified with phenol-chloroform method. In the following reverse transcription step, PCR templates was removed by gDNA digester (YEASEN; 11141ES10), followed by cDNA synthesis with primer (5'-ACGTGTCATGACTGACACTGGCAGTACGTAGCAGTGGTAGAACCTTCGTGTGC-3') and paired DNA oligo (5'-TTCTACCACGGAACTGCTACGTACTGCCAGTGTCAGTCATGACACGT-3'). following the protocol (YEASEN; 11141ES10). The artificial R-loop was purified by 2 volumes of SPRIselect beads. 10 ng purified artificial R-loop was mixed with 20 U mung bean nuclease, S1 nuclease, dsDNase, dsDNA Fragmentase respectively, and incubated at 37°C for 10 min. The digested product was purified using 1.8 volumes of SPRIselect beads. Purified product was DRIPed and used for ssDNA library construction as described previously (ssDRIP-seq, Xu et al., 2017). The library was sequenced on an Illumina NovaSeq system.