Instrument: Illumina HiSeq 2000
Strategy: miRNA-Seq
Source: TRANSCRIPTOMIC
Selection: size fractionation
Layout: SINGLE
Construction protocol: Leaf tissue was collected from individual plants at six time points: 0, 1, 2, 3, 7 and 10 DAT where 0 DAT corresponded to tissue sampled immediately at the end of the 5-day stress exposure period, prior to their return to the non-stressful growth conditions. Leaf tissue pieces, approximately 2.5 cm in length, were pooled from the eight plants that represented each treatment and replicate. The harvested leaf tissue pools were flash-frozen and stored in liquid nitrogen until RNA extraction. For the latter, tissue samples were ground to a fine powder with liquid nitrogen in a mortar and pestle. Total RNA was isolated from homogenized tissue samples using TRI-reagent as per manufacturer’s instructions (Ambion, Naugatuck, CT). Total RNA quality and quantity were assessed on an Agilent 2100 Bioanalyzer with the RNA 6000 Nano chip (Agilent Technologies, Santa Clara, CA). A total of 72 high-quality total RNA samples, corresponding to three biological replicates, four treatments and six sampling time points, were produced. Small RNA libraries were constructed for each of the 72 samples from 5 µg of total RNA using a plate-based method developed at the BC Cancer Agency Genome Sciences Centre (Vancouver, BC, Canada). Briefly, total RNA samples were mixed with oligo-dT microbeads and loaded into a 96-well MACS column (Miltenyi Biotec, Germany). The sRNA fractions were recovered from the flow-through and precipitated with ethanol. Quality was assessed for a subset of 12 samples using an Agilent Bioanalyzer RNA 6000 Nano chip (Agilent Technologies). An adenylated 3’-adapter (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTGT /3ddC/3’) was ligated using a truncated T4 RNA ligase (New England BioLabs, Ipswich, MA) by incubating at 22°C for 1 hour. An RNA 5’-adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA-3’) was then added using a T4 RNA ligase (Ambion) by incubating at 37°C for 1h. The first strand cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) and RT primer (5'-CAAGCAGAAGACGGCATACGAGAT-3’). The cDNA was used as template for PCR amplification where unique index sequences were introduced to enable identification of the pooled libraries. PCR cycling conditions were 98°C for 30 sec, followed by 15 cycles at 98°C for 15 sec, 62°C for 30 sec and 72°C for 15 sec and a final incubation at 72°C for 5 min. The quality of the libraries was assessed using a Caliper LabChipGX DNA chip (PerkinElmer, Waltham, MA). Three pools of randomly assigned sRNA libraries were created, resolved on a gel and, the 145-160 bp fractions were size-selected. Pooled libraries were ethanol precipitated and quality checked using an Agilent Bioanalyzer DNA1000 chip (Agilent Technologies). Each pooled library was diluted for cluster generation on a HiSeq 2000 flow cell according to manufacturer’s instructions. Small RNA sequencing was performed using a 50 cycle HiSeq SBS v4 kit