Name: GSM7993301
Instrument: Illumina MiSeq
Strategy: OTHER
Source: GENOMIC
Selection: other
Layout: SINGLE
Construction protocol: DNA was extracted from fecal samples using the Invitrogen Purelink™ Microbiome DNA Purification Kit according to the manufacturer’s instructions, following two minutes of bead beating (Bio Spec). Following DNA extraction, the V4 variable region of the bacterial 16S rRNA gene was amplified by polymerase chain reaction (PCR) using the 515F and 806R primers, and each sample received a unique 515F barcoded primer. Primer sequences used were: 515F- (barcode) 5′-AATGATACGGCGACCACCGAGATCTACACGCTAGCCTTCGTCGCTATGGTAATTGTG TGYCAGCMGCCGCGGTAA-3′ and 806 R 5′- CAAGCAGAAGACGGCATACGAGATAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT -3′ 31. PCR reactions were carried out with the Primestar taq polymerase (Takara) for 30 cycles of denaturation (95 °C), annealing (55 °C) and extension (72 °C), and a final elongation at 72 °C. Amplicons were purified using AMPure magnetic beads (Beckman Coulter), and subsequently quantified using Picogreen dsDNA quantitation kit (Invitrogen). Samples were pooled at equal concentrations (50 ng/µl), loaded on 2% E-Gel (Thermo Fisher), and purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel).