U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX001530: 454 sequencing of Rhagoletis pomonella bodies genomic fragment library
2 LS454 (454 GS FLX) runs: 121,251 spots, 33.6M bases, 71.6Mb downloads

Submitted by: Western Washington University
Study: Rhagoletis pomonella transcriptome sequencing project
show Abstracthide Abstract
cDNA that was generated from mRNA extracted from a variety of different life stages of Rhagoletis pomonella ranging from larvae to adults. We collected larvae (stages L2 and L3) from field-infested apples in Urbana, IL, during the summer of 2007. Larvae were dissected from infested apples and washed with water before being shock-frozen on dry ice. We obtained pupae from infested hawthorn fruit in South Bend, IN, during the fall of 2006. Infested fruit was transported to the laboratory where larvae emerged and pupated. One set of pupae was transferred to 4C after a prediapause period of two weeks and kept under diapause conditions for 4 months. A second set of pupae was kept at 25C until eclosion. Samples were taken from each set of individuals in regular intervals and shock-frozen at -80C. After removal from diapause additional samples were taken from the first set representing post-diapause developmental stages. Hawthorn race adults were obtained when pupae held at 25C eclosed. Apple race adults were caught on fruit in an apple orchard in Urbana, IL, in the summer of 2008. Live adults were shock-frozen on dry ice and the heads were separated from the adult bodies
Sample: Generic sample from Rhagoletis pomonella
SAMN00000747 • SRS001171 • All experiments • All runs
Library:
Name: R_pomonella_454_EST_1_bodies
Instrument: 454 GS FLX
Strategy: EST
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: SINGLE
Spot descriptor:
          
Group tagBasecalls
TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTCTTTTTTTTTT|AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG
-1  Adapter

Runs: 2 runs, 121,251 spots, 33.6M bases, 71.6Mb
Run# of Spots# of BasesSizePublished
SRR00565266,27518.6M42.5Mb2008-11-13
SRR00565354,97614.9M29.1Mb2008-11-13

ID:
1531

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...