Instrument: Illumina HiSeq 2500
Strategy: OTHER
Source: TRANSCRIPTOMIC
Selection: other
Layout: SINGLE
Construction protocol: Cells were incubated with 100 μg/ml of cycloheximide (Sigma Aldrich) for 5 minutes at 37°C, washed twice with ice-cold PBS containing 100 μg/ml of cycloheximide and lysed in 10 mM Tris-HCl (pH 7.4), 5 mM MgCl2, 100 mM KCl, 1% Triton X-100, 3 mM DTT, 100 μg/ml cycloheximide, 500 U/ml RNasin (Promega) and 1x Complete Protease Inhibitor, EDTA-free (Roche). Lysates for ribosome profiling were prepared and ribosome protected RNA fragments (RPFs) were isolated as described previouslywith the following modifications: rRNA was depleted using the RiboMinus Eukaryote Kit v2 (Thermo Fisher Scientific) by following the manufacturer's instructions. rRNA depleted RPFs were purified with the Zymo RNA Clean & Concentrator-5 kit by following the manufacturer's instructions for small RNAs. PAGE purification of RPFs was performed as described previously and resulting RPFs were dephosphorylated in FastAP mix (19.5 µl H2O, 2.5 µl 10x FastAP buffer (Thermo Fisher Scientific), 2.5 U FastAP enzyme (1 U/µl; Thermo Fisher Scientific), 0.5 µl Murine RNase Inhibitor (New England Biolabs)) and incubating for 20 minutes at 37°C. In the meantime, polynucleotide kinase mix was prepared (57 µl H2O, 10 µl 10x PNK buffer (New England Biolabs), 0.5 µl Murine RNase Inhibitor, 6.5 µl T4 PNK (10 U/µl; New England Biolabs), 1 µl TURBO DNase) and added 75 µl to each 25 µl sample and incubated 20 minutes at 37°C. RPFs were purified with the Zymo RNA Clean & Concentrator-5 kit following the manufacturer's instructions for small RNAs. RNA was eluted in 7 µl H2O, 1.5 µl DMSO and 10 pM 3' adapter (/Phos/AGATCGGAAGAGCACACGTCTG/ddC) were added before denaturation at 65°C for 2 minutes and transferring samples to ice. Subsequently, 11 µl ligation mix was added (2 µl 10x T4 RNA ligation buffer (New England Biolabs), 0.3 µl DMSO, 0.2 µl ATP, 0.3 µl RNAse inhibitor, 7 µl 50% PEG 8000, 1.2 µl T4 RNA Ligase 1 High Concentration (New England Biolabs)) using low retention pipette tips and incubated 1 hour at 23°C with agitation. Ligation reactions were purified to remove free 3' adapter using Silane bead purifications. For each reaction, 15 µl Silane beads (Thermo Fisher Scientific) were washed twice in 1 ml RLT buffer (Qiagen), beads were resuspended in 60 µl RLT, and 60 µl beads in RLT was combined with 20 µl ligation reaction. 0.7 volumes 100% ethanol were added and incubated for 10 minutes at room temperature. Supernatant was removed and beads were washed twice with 70 % ethanol before eluting air-dried beads in 10 µl H2O. Next, 10 pM reverse transcription primer (/5'biotin/GACGTGTGCTCTTCCGA) was added and samples were denatured at 72°C for 3 minutes before transferring to ice. To each reaction 7 µl reverse transcription mix (0.25 µl H2O, 2 µl 5x Smartscribe first strand buffer (Takara), 0.25 µl RNase inhibitor, 2 µl Smartscribe RT (Takara), 2 µl dNTP, 0.5 µl 20 mM DTT) were added and samples were incubated at 42°C for 15 minutes. Next, 2 µl template-switching oligo (5'biotin/TACACGACGCTCTTCCGATCTrGrG+G) were added and samples were incubated 90 minutes at 42°C, followed by 10 minutes at 70°C. Samples were purified with Silane beads and subjected to PCR amplification using 2x NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) as described previously. Amplicons migrating at a size of ~157 bp were subjected to two consecutive rounds of gel purification. For preparation of mRNA sequencing libraries, total RNA was extracted with the Direct-zol RNA MiniPrep Plus Kit (Zymo Research) according to the manufacturer's instructions. Total RNA was poly-A selected using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs) according to the manufacturer's instructions. mRNA was eluted in 27 µl H2O, 3 µl 10x FastAP buffer were added and RNA was heat fragmented for 3 minutes at 91°C. Fragmented RNA was end-repaired, adapter ligated, reverse transcribed and PCR amplified.