Name: GSM7039254
Instrument: Illumina NovaSeq 6000
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: SINGLE
Construction protocol: Cells were harvested 14 days post senescence induction. Growth media was removed, and the cells were washed with cold PBS containing 100 μg/ml of cycloheximide. Cells were subsequently scraped and pelleted, and later stored at -80°C until they were dispatched for sequencing. Stranded mRNA-seq libraries were generated from flash frozen cell pellets. Cell pellets were lysed in ice-cold polysome lysis buffer (20mM Tris pH 7.5, 150mM NaCl, 5mM MgCl2,1mM DTT, 1% Triton X-100) supplemented with cycloheximide (100µg/mL). For stranded mRNA-seq, total RNA was extracted from 10% of lysate using TRIzol, before mRNA was poly(A)-enriched, fractionated, and converted into Illumina compatible cDNA libraries. Stranded mRNA-seq libraries were sequenced 150PE on Illumina's Nova-seq 6000 platform to depths of 20 million raw read pairs per sample. For Ribo-seq, the remaining lysates which were not used for RNA-seq were RNase- treated before ribosomes were enriched by size exclusion chromatography using MicroSpin S-400 HR columns. Following RNA purification and size selection of ribosome protected mRNA fragments on 15% urea PAGE gels, contaminating rRNA was depleted from samples using EIRNA Bio's custom biotinylated rRNA depletion oligos before the enriched fragments were converted into Illumina compatible cDNA libraries. Ribo-seq libraries were sequenced 150PE on Illumina's Nova-seq 6000 platform to a depth of 100 million raw read pairs per sample. The sequence structure of these reads is as follows: • UUUUUUUUUUUU - QQQQ - rpf sequence - NNNNN - BBBBB – AGATCGGAAGAGCACACGTCTGAA • The first 12nt are unique molecular identifiers (UMIs) (can be any 12 nt). • The next 4nt are untemplated additions (Usually C or G). • The read begins with the sequence of interest. • The next 5nt are unique molecular identifiers (UMIs) (can be any 5 nt). • The next 5nt are the Barcode used to demultiplex (the fastq files have already been demultiplexed). • The adapter sequence – AGATCGGAAGAGCACACGTCTGAA