Name: GSM5932283
Instrument: Illumina HiSeq 4000
Strategy: OTHER
Source: TRANSCRIPTOMIC
Selection: other
Layout: SINGLE
Construction protocol: For sample collection of BAT/WAT/Beige cultures for Ribo-Seq and total mRNA-Seq used for smORF discovery, each culture was washed directly out of the incubators 3x with ice-cold PBS supplemented with 100μg/mL cyclohexamide (Fisher Scientific #AAJ66004X). After the last wash, liquid nitrogen was gently ladled onto the surfaces of the cells and plates were stored at -80 °C prior to Ribo-Seq analysis. Each biological replicate for Ribo-Seq in our experiments represents 11 wells of a 6-well dish leaving one well to be lysed with Trizol reagent (Thermo #15596026) for the bulk mRNA-Seq used int the de novo transcriptome assembly of the cells under analysis. Cells were lysed with 400 μl of ice-cold lysis buffer (20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 5 mM MgCl2, 1% Triton X-100, with 1 mM DTT, 25 U ml−1 Turbo DNase (Thermo Fisher, catalog no. AM2238) and 100 μg ml−1 CHX added fresh) was dripped onto the plate. Cells were incubated on ice in lysis buffer for 10 min with periodic vortexing and pipetting to disperse the cells. The lysate was then clarified by centrifugation at 15,000g for 10 min. Cell lysates were flash-frozen in liquid nitrogen and stored at −80 °C for up to 7 d before ribosome footprinting. For each cell type, ribosome footprinting was carried out by digesting 40-60 μg of RNA in 200-300 μL lysate with 0.375 U/μg−1 RNase I (Lucigen, N6901K) for 50 min at room temperature. Digestion reactions were quenched with 200 U Superase-In RNase I inhibitor (Thermo Fisher, AM2694) on ice. Following digestion, monosomes were purified from small RNA fragments using MicroSpin S-400 HR columns (GE Life Sciences), and ribosome protected RNA fragments (RPFs) were extracted by acid phenol chloroform and isopropanol precipitation. Sequencing libraries were prepared as in (McGlincy et al. 2017) with some modifications. First, the Ribo-Zero Mammalian Kit (Illumina) was used to deplete rRNA after RPF extraction and just prior to RPF size selection by gel extraction. Second, the Zymo clean & concentrator step after adaptor ligation is omitted and the reaction was carried over straight into reverse transcription. For the reverse transcription step to form cDNA, Episcript RT(Lucigen, ERT12910K) was used. Following reverse transcription, excess primer was degraded using Exonuclease I (Lucigen, X40520K) and the RNA templates were degraded using Hybridase (Lucigen, H39500). For the cDNA circularization step, CircLigase I (Lucigen, CL4111K) was used. PCR amplification was then carried out using Phusion Hot Start II High-Fidelity Master Mix (Thermo Fisher, F565L) for 9-12 cycles. The adapters and primers for library construction used were as follows: 3' adapter – 5'-/5phos/AGATCGGAAGAGCACACGTCTGAA/3ddC/-3'; RT primer – 5'-/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAG/iSp18/GTGACTGGAGTTCAGACGTGTGCTC-3'; PCR forward primer – 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3'; Illumina TruSeq Ribo Profile (Mammalian) Library Prep Kit index primers 1 – 12. Ribosome footprinting