Name: E8-B001630-4_16-32-1-1_S188_R1_001_p
Instrument: Illumina NovaSeq 6000
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC SINGLE CELL
Selection: PolyA
Layout: PAIRED
Construction protocol: Thymic lobes were enzymatically digested using Liberase (Roche) and DNaseI (PanReac AppliChem). In order to enrich for TEC, thymic digests were subsequently depleted of CD45+ cells using a magnetic cell separator (AutoMACS, Miltenyi) before washing and preparation for flow cytometry. Cells were stained at a concentration of 5-10 x106 per 100µl in FACS buffer (2% fetal calf serum in PBS or 5% bovine serum albumin in PBS). Staining for cell surface markers was performed for 20 minutes at 4°C, except for CCR7 which was performed for 30 minutes at 37°C in a water bath prior to the addition of other cell surface stains. The FoxP3 Transcription Factor Staining Buffer Kit (eBioscience) was used according to manufacturer's instructions in order to stain for intracellular antigens. Cell viability was assessed using DAPI staining or LIVE/DEAD Fixable Aqua Dead Cell Stain (Invitrogen). Samples were acquired and sorted using a FACS Aria III (BD Biosciences). Sorted TEC phenotypes were: mTEChi (CD45-EpCAM+Ly51-CD80+MHCII+), mTEClo (CD45-EpCAM+Ly51-CD80loMHCIIloDsg3-), Dsg3+ TEC (CD45-EpCAM+Ly51-CD80loMHCIIloDsg3+) and cTEC (CD45-EpCAM+Ly51+CD80-). For single-cell RNA-sequencing index sorting was used and cells were sorted into 384 well plates. Single thymic epithelial cells were index FAC-sorted into 384-well lysis plates. Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma, 93443-100ML), 3.125 mM dNTP mix (Thermo Fisher, R0193), 3.125 μM Oligo-dT 30 VN (IDT, 5'AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3') and 1:600,000 ERCC RNA spike in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901) using a Tempest liquid handler (Formulatrix). All plates were then spun down for 1 minute at 3220 X g and snap frozen on dry ice. Plates were stored at -80°C until used for sorting. cDNA synthesis was performed using the Smart-seq2 protocol (Picelli et al., 2014). Briefly, 384-well plates containing single-cell lysates were thawed on ice followed by first strand synthesis. 0.6 μl of reaction mix (16.7 U/μl SMARTScribe TM Reverse Transcriptase (Takara Bio, 639538), 1.67 U/μl Recombinant RNase Inhibitor (Takara Bio, 2313B), 1.67X First-Strand Buffer (Takara Bio, 639538), 1.67 μM TSO (Exiqon, 5'-AAGCAGTGGTATCAACGCAGACTACATrGrG+G-3'), 8.33 mM DTT (Bioworld, 40420001-1), 1.67 M Betaine (Sigma, B0300-5VL), and 10 mM MgCl 2 (Sigma, M1028-10X1ML)) was added to each well using a Tempest liquid handler. Bulk wells received twice the amount of RT mix (1.2 μl). Reverse transcription was carried out by incubating wells on a ProFlex 2x384 thermal-cycler (Thermo Fisher) at 42°C for 90 min and stopped by heating at 70°C for 5 min. Subsequently, 1.6 μl of PCR mix (1.67X KAPA HiFi HotStart ReadyMix (Kapa Biosystems, KK2602), 0.17 μM IS PCR primer (IDT, 5'-AAGCAGTGGTATCAACGCAGAGT-3'), and 0.038U/μl Lambda Exonuclease (NEB, M0262L)) was added to each well with a Tempest liquid handler (Formulatrix). Bulk wells received twice the amount of PCR mix (3.2 μl). Second strand synthesis was performed on a ProFlex 2x384 thermal-cycler using the following program: 1. 37°C for 30 minutes, 2. 95°C for 3 minutes, 3. 23 cycles of 98°C for 20 seconds, 67°C for 15 seconds, and 72°C for 4 minutes, and 4. 72°C for 5 minutes. The amplified product was diluted with a ratio of 1 part cDNA to 10 parts 10mM Tris-HCl (Thermo Fisher, 15568025), and concentrations were measured with a dye-fluorescence assay (Quant-iT dsDNA High Sensitivity kit; Thermo Fisher, Q33120) on a SpectraMax i3x microplate reader (Molecular Devices). These wells were reformatted to a new 384-well plate at a concentration of 0.3 ng/μl and final volume of 0.4 μl using an Echo 550 acoustic liquid dispenser (Labcyte). If the cell concentration was below 0.3 ng/μl, 0.4 μl of sample was transferred. Illumina sequencing libraries were prepared using the Nextera XT Library Sample Preparation kit (Illumina, FC-131-1096) (Darmanis et al. 2017; Tabula Muris Consortium et al. 2018). Each well was mixed with 0.8 μl Nextera tagmentation DNA buffer (Illumina) and 0.4 μl Tn5 enzyme (Illumina), then tagmented at 55°C for 10 min. The reaction was stopped by adding 0.4 μl "Neutralize Tagment Buffer" (Illumina) and spinning at room temperature in a centrifuge at 3220 X g for 5 min. Indexing PCR reactions were performed by adding 0.4 μl of 5 μM i5 indexing primer, 0.4 μl of 5 μM i7 indexing primer, and 1.2 μl of Nextera NPM mix (Illumina). PCR amplification was carried out on a ProFlex 2x384 thermal cycler using the following program: 1. 72°C for 3 minutes, 2. 95°C for 30 seconds, 3. 12 cycles of 95°C for 10 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and 4. 72°C for 5 minutes.