oligonucleotides - PubChem Compound - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from PubChem Compound

an image of a chemical structure CID 16133899

oligonucleotides; ACACCCAATTCTGAAAATGG; 5'-ACACCCAATTCTGAAAATGG-3' ...

MW:: 6094.000
MF:: C₁₉₅H₂₄₅N₇₈O₁₁₄P₁₉

IUPAC name:: [3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[3-[[5-(2-amino-6-ox...

Create Date:: 2007-07-04

CID:: 16133899

Summary Same Parent, Connectivity PubMed (MeSH Keyword)

Supplemental Content

Actions on your results

View or Download Structures in PubChem

Related information

Gene
Genes
Taxonomy
Taxonomy
Same, Stereochemistry
Related PubChem Identical Compounds (Same, Stereochem.)
Same, Isotopes
Related PubChem Identical Compounds (Same, Isotopic)
Same, Connectivity
Related PubChem Identical Compounds (Same, Connectivity)
Same, Any Tautomer
Related PubChem Identical Compounds (Same, Any Tautomer)
Parent Compound
Parent Compound
Same Parent
Same Parent
Same Parent, Stereochemistry
Same Parent, Stereochemistry
Same Parent, Isotopes
Same Parent, Isotopes
Same Parent, Connectivity
Same Parent, Connectivity
Same Parent, Any Tautomer
Same Parent, Any Tautomer
PubChem Same Substances
Related PubChem Substance
PubMed Citations
Related PubMed Citation
PMC Articles
PubMed Central Links
PubMed (MeSH Keyword)
Related PubMed via MeSH
MeSH Keyword
Related MeSH

Recent activity

Clear Turn Off Turn On

Same, Any Tautomer for PubChem Compound (Select 16133899) (1)
PubChem Compound
OMIM Links for Nucleotide (Select 1674985952) (1)
OMIM
txid543981[Organism:noexp] (3)
SRA

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

You are here: NCBI > Chemicals & Bioassays > PubChem Compound