Alternative titles; symbols
HGNC Approved Gene Symbol: MIR371A
Cytogenetic location: 19q13.42 Genomic coordinates (GRCh38): 19:53,787,675-53,787,741 (from NCBI)
MicroRNAs (miRNAs), such as MIR371, are small noncoding RNAs that interact with target mRNAs to downregulate gene expression via mRNA degradation or translation inhibition (Voorhoeve et al., 2007).
By screening for miRNAs that cooperate with oncogenes in cellular transformation, Voorhoeve et al. (2007) identified an miRNA gene cluster containing miR371, miR372 (612044), and miR373 (611954). Further analysis suggested that miR372 and miR373 were involved in transformation, but not miR371.
Gross (2015) mapped the MIR371A gene to chromosome 19q13.42 based on an alignment of the mature MIR371A sequence (GUGCCGCCAUCUUUUGAGUGU) with the genomic sequence (GRCh38).
Voorhoeve et al. (2007) found that the MIR371, MIR372, and MIR373 genes are clustered within a 1.3-kb region. The MIR371 and MIR372 genes are closely linked within a 0.5-kb region that is about 0.35 kb from the MIR373 gene.
Gross, M. B. Personal Communication. Baltimore, Md. 4/6/2015.
Voorhoeve, P. M., le Sage, C., Schrier, M., Gillis, A. J. M., Stoop, H., Nagel, R., Liu, Y.-P., van Duijse, J., Drost, J., Griekspoor, A., Zlotorynski, E., Yabuta, N., De Vita, G., Nojima, H., Looijenga, L. H. J., Agami, R. A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Adv. Exp. Med. Biol. 604: 17-46, 2007. [PubMed: 17695719] [Full Text: https://doi.org/10.1007/978-0-387-69116-9_2]