GEO Profiles Links for Nucleotide (Select 6099585) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 38

<< First< Prev

Page of 2

Next >Last >>

Select item 56469161.

Gm6158 - Spermatogonial stem cell activity in testis laminin binding germ cells (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS701, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 5646916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47712162.

Gm6158 - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS606, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4771216

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 26657163.

Gm6158 - Spermatogenesis time course (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS409, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2665716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 571769164.

Gm6158 - Embryonic stem cell response to STAT3 overexpression in vitro (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS3445, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57176916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 224087165.

Gm6158 - Positively selected H-2b T cell receptor transgenic thymocytes (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS1934, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 22408716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 52351166.

Gm6158 - Testis developmental time course: embryonic (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS661, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 5235116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 52877167.

Gm6158 - Ovary developmental time course: embryonic (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS665, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 5287716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 232301168.

Gm6158 - Airway disease trait manifestation in various genetic backgrounds: lungs (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS1987, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 23230116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 29567169.

Gm6158 - Stem cell self renewal and Bmi-1 (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS429, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 2956716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1729381610.

Gm6158 - POU-domain transcription factor Brn3a knockout effect on embryonic ganglia (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS1652, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 17293816

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752942111.

Cnot1 - MPSS transcriptome analysis project

Annotation:: Cnot1, CCR4-NOT transcription complex, subunit 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCGTAAATGTTCCGTGAA (ID_REF), GDS868, AW124055

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7529421

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 698581612.

Gm6158 - Spermatogonia in Zfp145 knockout (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS836, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 6985816

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 542511613.

Gm6158 - Down syndrome and brain (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS682, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 5425116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 390771614.

Gm6158 - Intestinal tract gene expression (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS522, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 3907716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5489721615.

Gm6158 - STAT5 depleted pro-B cell line response to IL-3: time course (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS3350, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 54897216

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1696301616.

Gm6158 - Osteoblast differentiation (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS1632, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 16963016

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1734541617.

Gm6158 - Dendritic cell subpopulations: spleen (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS1657, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 17345416

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1468061618.

Gm6158 - Transcription factor Tcf1 knockout effect on pancreatic islets (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS1474, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 14680616

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 415251619.

Gm6158 - Mesangioblast stem cell clone comparison (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS554, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 4152516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2319201620.

Gm6158 - Primary visual cortex response to visual input deprivation (MG-U74B)

Annotation:: Gm6158, predicted gene 6158 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL82, 104784_at (ID_REF), GDS1984, 234594 (Gene ID), 620499 (Gene ID), AW124055

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23192016

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 6099585) (38)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 38

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity