GEO Profiles Links for Nucleotide (Select 164565422) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 1199

<< First< Prev

Page of 60

Next >Last >>

Select item 1304691731.

Ceacam2 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P9671 (ID_REF), GDS5666, NM_007543, A_52_P9671 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130469173

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 727783162.

Ceacam2 - Intestinal microbiota depletion effect on colon epithelial cells

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1239472 (ID_REF), GDS3921, NM_007543, CEACAM2 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 72778316

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 546174203.

Ceacam2 - Skin carcinogenesis model

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL4234, 2970292 (ID_REF), GDS3334, NM_007543

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54617420

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74677944.

Ceacam2 - MPSS transcriptome analysis project

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCCAGCTTCTCTGCCT (ID_REF), GDS868, NM_007543

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7467794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1291232255.

Ceacam2 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P171728 (ID_REF), GDS5629, NM_007543, A_51_P171728 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129123225

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1128925196.

Ceacam2 - Renal tubular von Hippel-Lindau protein preconditional knockout effect on rhabdomyolysis-induced AKI kidney

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL6246, 10561055 (ID_REF), GDS4864, NM_001113368, NM_001113369, NM_007543, AB500065, AB731450, AF101164, BC024320, chr7:25516040-25539857 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 112892519

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1052563197.

Ceacam2 - Methylmalonic acidemia-associated renal disease model: kidney

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL6246, 10561055 (ID_REF), GDS4839, NM_001113368, NM_001113369, NM_007543, AB500065, AB731450, AF101164, BC024320, chr7:25516040-25539857 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 105256319

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 518317758.

Ceacam2 - Interleukin-22 effect on colon cultures

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL2872, 43675 (ID_REF), GDS3226, NM_007543, A_52_P240706 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51831775

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 388143989.

Ceacam2 - Pubertal mammary gland development

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL339, 1421603_a_at (ID_REF), GDS2721, 26367 (Gene ID), NM_007543

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38814398

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1720140910.

Ceacam2 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL1261, 1421603_a_at (ID_REF), GDS1647, 26367 (Gene ID), NM_007543

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17201409

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13181391611.

Ceacam2 - Anti-CTLA-4 immunotherapy effect on αSMA+ myofibroblast late-depleted pancreatic ductal adenocarcinoma model

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1239472 (ID_REF), GDS5822, NM_007543, CEACAM2 (ORF)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 131813916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13176721612.

Ceacam2 - αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1239472 (ID_REF), GDS5821, NM_007543, CEACAM2 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131767216

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11532724013.

Ceacam2 - Glucocorticoid effect on the female liver

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL4134, 29540 (ID_REF), GDS5036, NM_007543, A_52_P240706 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115327240

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11528064014.

Ceacam2 - Glucocorticoid effect on the male liver

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL4134, 29540 (ID_REF), GDS5035, NM_007543, A_52_P240706 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115280640

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7946581915.

Ceacam2 - Model for inflammatory signaling in prostate epithelium based on expression of a constitutively active version of IκB kinase 2 (IKK2ca)

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL6246, 10561055 (ID_REF), GDS4119, NM_001113368, NM_001113369, NM_007543, AB500065, AB731450, AF101164, BC024320, chr7:25516040-25539857 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 79465819

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5050729816.

Ceacam2 - pRb p107 double deficient skin

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL339, 1421603_a_at (ID_REF), GDS3176, 26367 (Gene ID), NM_007543

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 50507298

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13172051617.

Ceacam2 - αSMA+ myofibroblast early depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1239472 (ID_REF), GDS5820, NM_007543, CEACAM2 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131720516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12706274018.

Ceacam2 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL4134, 29540 (ID_REF), GDS5461, NM_007543, A_52_P240706 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127062740

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7168296419.

Ceacam2 - Fasting effect on multiple tissues: time course

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL11012, 17464 (ID_REF), GDS3893, NM_007543

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71682964

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13272871620.

Ceacam2 - Diet-induced obesity model: liver

Annotation:: Ceacam2, carcinoembryonic antigen-related cell adhesion molecule 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1239472 (ID_REF), GDS6248, NM_007543, CEACAM2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 51 samples

ID:: 132728716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 60

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 164565422) (1199)
GEO Profiles
Mus musculus CEA cell adhesion molecule 2 (Ceacam2), transcript variant 3, mRNA
Mus musculus CEA cell adhesion molecule 2 (Ceacam2), transcript variant 3, mRNA
gi|164565422|ref|NM_007543.4|

Nucleotide
Mus musculus excision repair cross-complementing rodent repair deficiency, compl...
Mus musculus excision repair cross-complementing rodent repair deficiency, complementation group 3, mRNA (cDNA clone IMAGE:5368172), with apparent retained intron
gi|18606469|gb|BC022956.1|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 1199

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity