GEO Profiles Links for Nucleotide (Select 12805182) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 577

<< First< Prev

Page of 29

Next >Last >>

Select item 755567401.

Hmgb2 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10510172 (ID_REF), GDS3999, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146563790-146565169 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75556740

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 755576392.

Hmgb2 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518352 (ID_REF), GDS3999, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:147086418-147086986 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75557639

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 755576383.

Hmgb2 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518350 (ID_REF), GDS3999, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146224119-146224663 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75557638

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75150284.

Hmgb2 - MPSS transcriptome analysis project

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAAATTGAACACCCAG (ID_REF), GDS868, BC002050

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7515028

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1181643395.

Hmgb2 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518352 (ID_REF), GDS5226, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:147086418-147086986 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118164339

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1268281406.

Hmgb2 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10510172 (ID_REF), GDS5456, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146563790-146565169 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126828140

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1268290387.

Hmgb2 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518350 (ID_REF), GDS5456, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146224119-146224663 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126829038

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1268290398.

Hmgb2 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518352 (ID_REF), GDS5456, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:147086418-147086986 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126829039

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1181643389.

Hmgb2 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518350 (ID_REF), GDS5226, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146224119-146224663 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118164338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11816344010.

Hmgb2 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10510172 (ID_REF), GDS5226, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146563790-146565169 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118163440

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7556374711.

Hmgb2 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10571870 (ID_REF), GDS3999, NM_008252, BC002050, BC046759, BC083108, X67668, chr8:57511876-57514494 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75563747

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11817044712.

Hmgb2 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10571870 (ID_REF), GDS5226, NM_008252, BC002050, BC046759, BC083108, X67668, chr8:57511876-57514494 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118170447

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10785584713.

Hmgb2 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10571870 (ID_REF), GDS4944, NM_008252, BC002050, BC046759, BC083108, X67668, chr8:57511876-57514494 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107855847

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8122144014.

Hmgb2 - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10510172 (ID_REF), GDS4162, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146563790-146565169 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81221440

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8122233815.

Hmgb2 - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518350 (ID_REF), GDS4162, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146224119-146224663 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81222338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10784884016.

Hmgb2 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10510172 (ID_REF), GDS4944, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146563790-146565169 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107848840

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10784973817.

Hmgb2 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518350 (ID_REF), GDS4944, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:146224119-146224663 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107849738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10784973918.

Hmgb2 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10518352 (ID_REF), GDS4944, NM_008252, BC002050, BC046759, BC083108, X67668, chr4:147086418-147086986 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107849739

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8122844719.

Hmgb2 - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL6246, 10571870 (ID_REF), GDS4162, NM_008252, BC002050, BC046759, BC083108, X67668, chr8:57511876-57514494 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81228447

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448678120.

Hmgb2 - Zygotic gene activation

Annotation:: Hmgb2, high mobility group box 2

Organism:: Mus musculus

Reporter:: GPL870, 17681 (ID_REF), GDS579, AK003773, AK008443, AK012568, AK014053, AK076075, BC002050, BC046759, CL211075, L0006D08-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4486781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 29

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 12805182) (577)
GEO Profiles
PREDICTED: Mus musculus isocitrate dehydrogenase 2 (NADP+), mitochondrial (Idh2)...
PREDICTED: Mus musculus isocitrate dehydrogenase 2 (NADP+), mitochondrial (Idh2), transcript variant X1, mRNA
gi|1720422786|ref|XM_006540911.4|

Nucleotide
Mus musculus adaptor-related protein complex 3, sigma 2 subunit (Ap3s2), mRNA
Mus musculus adaptor-related protein complex 3, sigma 2 subunit (Ap3s2), mRNA
gi|160707970|ref|NM_009682.3|

Nucleotide
Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4...
Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930445P06 product:peroxisomal biogenesis factor 11a, full insert sequence
gi|26097012|dbj|AK076776.1|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 577

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity