GEO Profiles Links for Nucleotide (Select 111185929) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 344

<< First< Prev

Page of 18

Next >Last >>

Select item 1092226211.

Tmprss13 - Diabetic db/db heart response to rosiglitazone

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL4134, 12721 (ID_REF), GDS4990, NM_001013373, A_51_P472120 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109222621

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1068182852.

Tmprss13 - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6246, 10584870 (ID_REF), GDS4899, NM_001013373, XM_006510132, BC085323, chr9:45319100-45347584 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106818285

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 787273603.

Tmprss13 - Human Epidermal Growth Factor Receptor 2-positive breast cancer MMTV-Her2/Neu murine model: primary and secondary mammary tumors

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2911788 (ID_REF), GDS4099, NM_001013373

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 78727360

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 787287314.

Tmprss13 - Human Epidermal Growth Factor Receptor 2-positive breast cancer MMTV-Her2/Neu murine model: primary and secondary mammary tumors

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1226348 (ID_REF), GDS4099, XM_150167

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 78728731

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1090587855.

Tmprss13 - Phorbol ester effect on skin of Rho exchange factor Vav2/Vav3 double knockout mutants: time course

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6246, 10584870 (ID_REF), GDS4985, NM_001013373, XM_006510132, BC085323, chr9:45319100-45347584 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 109058785

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553490416.

Tmprss13 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL5759, NM_001013373_at (ID_REF), GDS3385, NM_001013373

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55349041

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1224176287.

Tmprss13 - Anterior stomach vagotomy effect on INS-GAS gastric cancer model stomach: time course

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2911788 (ID_REF), GDS5336, NM_001013373, TMPRSS13 (ORF)

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122417628

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 731515858.

Tmprss13 - Adrenergic stress effect on transcription factor GATA4 S105A mutants: heart ventricle

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6246, 10584870 (ID_REF), GDS3931, NM_001013373, XM_006510132, BC085323, chr9:45319100-45347584 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 73151585

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1183007859.

Tmprss13 - Adam10 deficiency effect on the epidermis

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6246, 10584870 (ID_REF), GDS5229, NM_001013373, XM_006510132, BC085323, chr9:45319100-45347584 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118300785

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5465038410.

Tmprss13 - Skin carcinogenesis model

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL4234, 105910408 (ID_REF), GDS3334, XM_150167

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54650384

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11086528511.

Tmprss13 - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6246, 10584870 (ID_REF), GDS5052, NM_001013373, XM_006510132, BC085323, chr9:45319100-45347584 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110865285

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12091373612.

Tmprss13 - T helper type 9 cells

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P472120 (ID_REF), GDS5291, NM_001013373, A_51_P472120 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120913736

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7283513613.

Tmprss13 - Spatial and temporal development of mammalian salivary glands

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P472120 (ID_REF), GDS3922, NM_001013373, A_51_P472120 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72835136

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12397256014.

Tmprss13 - Homeobox protein Nanog transcription factor overexpression effect on colon and intestine cells

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2911788 (ID_REF), GDS5376, NM_001013373

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 123972560

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12241762715.

Tmprss13 - Anterior stomach vagotomy effect on INS-GAS gastric cancer model stomach: time course

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1226348 (ID_REF), GDS5336, NM_001013373, TMPRSS13 (ORF)

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 122417627

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12397393116.

Tmprss13 - Homeobox protein Nanog transcription factor overexpression effect on colon and intestine cells

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1226348 (ID_REF), GDS5376, XM_150167

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 123973931

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748392617.

Tmprss13 - MPSS transcriptome analysis project

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGCAATGAGCTTCC (ID_REF), GDS868, NM_001013373

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7483926

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 10326922818.

Tmprss13 - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2911788 (ID_REF), GDS4795, NM_001013373, TMPRSS13 (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103269228

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10326922719.

Tmprss13 - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1226348 (ID_REF), GDS4795, NM_001013373, TMPRSS13 (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103269227

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7506263620.

Tmprss13 - High-fat dietary restriction effect on epididymal white adipose tissue

Annotation:: Tmprss13, transmembrane protease, serine 13

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P472120 (ID_REF), GDS3986, NM_001013373, A_51_P472120 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 75062636

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 18

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 111185929) (344)
GEO Profiles
Taxonomy Links for Protein (Select 32567794) (1)
Taxonomy
Balistes vetula mitochondrion, complete genome
Balistes vetula mitochondrion, complete genome
gi|221145589|ref|NC_011948.1|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 344

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity