GEO Profile Links for Gene (Select 94275) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 138244251.

Maged1 - cAMP/protein kinaseA effect on cell-cycle regulation: timecourse

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL339, 1450062_a_at (ID_REF), GDS1409, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 13824425

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1300141002.

Maged1 - Lymphotoxin-β receptor agonist antibody effect on lipopolysaccharide-stimulated embryonic fibroblasts

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2661125 (ID_REF), GDS5655, NM_019791

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 130014100

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 423299573.

Maged1 - Myogenic transcription factor MyoD mutant expression effect on embryonic fibroblast: time course

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450062_a_at (ID_REF), GDS2854, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 42329957

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1237282004.

Maged1 - Ethanol effect on myoblast differentiation in vitro

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2661125 (ID_REF), GDS5370, NM_019791

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 123728200

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1244587575.

Maged1 - Neuron-specific T-box transcription factor deficiency effect on embryonic day 16.5 forebrains

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450062_a_at (ID_REF), GDS5389, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124458757

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1213392006.

Maged1 - Restless Legs Syndrome model: embryonic forebrain

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2661125 (ID_REF), GDS5300, NM_019791

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 121339200

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1248444007.

Maged1 - DPP4A overexpression effect on fibroblast cell line

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2661125 (ID_REF), GDS5400, NM_019791

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124844400

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746530488.

Maged1 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2661125 (ID_REF), GDS3974, NM_019791, MAGED1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74653048

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968070579.

Maged1 - MYBL1 transcription factor knockout effect on testes

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450062_a_at (ID_REF), GDS4485, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 96807057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6258357710.

Maged1 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6333, scl54036.9.4_13-S (ID_REF), GDS3621, NM_019791, Maged1 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62583577

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11594814811.

Maged1 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2661125 (ID_REF), GDS5157, NM_019791, MAGED1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115948148

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11431105712.

Maged1 - Glucose effect on young pancreatic islets: dose response and time course

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450062_a_at (ID_REF), GDS4942, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 114311057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746656313.

Maged1 - MPSS transcriptome analysis project

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCTTTACCTTCTGGG (ID_REF), GDS868, NM_019791

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7466563

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7567822914.

Maged1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6481, 6650332 (ID_REF), GDS4002, NM_019791, Maged1 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75678229

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7220005715.

Maged1 - Polyubiquitin knockout effect on testis: time course

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450062_a_at (ID_REF), GDS3906, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72200057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6833655716.

Maged1 - von Hippel-Lindau (VHL) tumor suppressor protein deficiency effect on pancreatic islet cells

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450062_a_at (ID_REF), GDS3800, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 68336557

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11143600017.

Maged1 - Insm1 deficiency effect on the fetal pituitary gland

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2661125 (ID_REF), GDS5066, NM_019791

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 111436000

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7636875718.

Maged1 - High-density lipoproteins effect on pancreatic β cells subjected to apoptotic stimuli

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450062_a_at (ID_REF), GDS4026, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 76368757

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12775414819.

Maged1 - Rosiglitazone effect on adipose progenitor cells

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2661125 (ID_REF), GDS5520, NM_019791, MAGED1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127754148

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2554035720.

Maged1 - Testis development

Annotation:: Maged1, melanoma antigen, family D, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1450062_a_at (ID_REF), GDS2098, 94275 (Gene ID), NM_019791

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 25540357

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 94275) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity