GEO Profile Links for Gene (Select 76641) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 84

<< First< Prev

Page of 5

Next >Last >>

Select item 44872331.

1700123N01Rik - Zygotic gene activation

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 18133 (ID_REF), GDS579, AB029142, AB029143, AB029144, AB029145, AB029146, AF013099, AF175574, AK007259, AK010969, BC009005, L0064A10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4487233

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129729942.

Psmd4 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL1345, 3394 (ID_REF), GDS1357, BG795252

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12972994

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756412123.

Psmd4 - High and Low Anxiety: multiple brain regions

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL7467, 3768 (ID_REF), GDS4001, AI846096

DataSet type:: Expression profiling by array, log2 ratio, 70 samples

ID:: 75641212

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 129741374.

Psmd4 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL1345, 4537 (ID_REF), GDS1357, BG795309

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12974137

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129726735.

Psmd4 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL1345, 3073 (ID_REF), GDS1357, BG795509

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12972673

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61544336.

1700123N01Rik - Blastocyst dormancy and activation comparison

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 18133 (ID_REF), GDS752, AB029142, AB029143, AB029144, AB029145, AB029146, AF013099, AF175574, AK007259, AK010969, BC009005, L0064A10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6154433

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 21972227.

1700123N01Rik - Ligand screen in B cells: tumor necrosis factor-alpha

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene

Organism:: Mus musculus

Reporter:: GPL260, 11692 (ID_REF), GDS322, AK007259

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2197222

GEO DataSets Gene Profile neighbors

Select item 78914788.

Psmd4 - Aquaporin-1 knockout kidney inner medulla profile (I)

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL1104, H3124D05 (ID_REF), GDS899, BG073583

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 7891478

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 32373499.

Psmd4 - Malaria resistance

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL519, 11849 (ID_REF), GDS471, AW550391

DataSet type:: Expression profiling by array, log ratio, 14 samples

ID:: 3237349

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1297273710.

Psmd4 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL1345, 3137 (ID_REF), GDS1357, BG796371

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12972737

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1561472511.

Psmd4 - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL2727, 29043 (ID_REF), GDS1527, BG073583, BG086311, H3124D05 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15614725

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7563909512.

Psmd4 - High and Low Anxiety: multiple brain regions

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL7467, 2275 (ID_REF), GDS4001, AI839495

DataSet type:: Expression profiling by array, log2 ratio, 70 samples

ID:: 75639095

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748999013.

Psmd4 - MPSS transcriptome analysis project

Annotation:: Psmd4, Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGGTGAAACTAGCTAA (ID_REF), GDS868, CB950580

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7489990

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 211322214.

1700123N01Rik - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene

Organism:: Mus musculus

Reporter:: GPL260, 11692 (ID_REF), GDS317, AK007259

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2113222

GEO DataSets Gene Profile neighbors

Select item 446393315.

1700123N01Rik - Preimplantation development

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 18133 (ID_REF), GDS578, AB029142, AB029143, AB029144, AB029145, AB029146, AF013099, AF175574, AK007259, AK010969, BC009005, L0064A10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4463933

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 214682216.

1700123N01Rik - Ligand screen in B cells: secondary lymphoid-organ chemokine

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene

Organism:: Mus musculus

Reporter:: GPL260, 11692 (ID_REF), GDS319, AK007259

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2146822

GEO DataSets Gene Profile neighbors

Select item 204602217.

1700123N01Rik - Ligand screen in B cells: nerve growth factor

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene

Organism:: Mus musculus

Reporter:: GPL260, 11692 (ID_REF), GDS313, AK007259

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2046022

GEO DataSets Gene Profile neighbors

Select item 104502218.

1700123N01Rik - Platform type/amplification method cross comparison (16K cDNA)(I)

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene

Organism:: Mus musculus

Reporter:: GPL260, 11692 (ID_REF), GDS224, AK007259

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1045022

GEO DataSets Gene Profile neighbors

Select item 176042219.

1700123N01Rik - Ligand screen in B cells: CD27

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene

Organism:: Mus musculus

Reporter:: GPL260, 11692 (ID_REF), GDS296, AK007259

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 1760422

GEO DataSets Gene Profile neighbors

Select item 221402220.

1700123N01Rik - Ligand screen in B cells: untreated

Annotation:: 1700123N01Rik, RIKEN cDNA 1700123N01 gene

Organism:: Mus musculus

Reporter:: GPL260, 11692 (ID_REF), GDS323, AK007259

DataSet type:: Expression profiling by array, log ratio, 41 samples

ID:: 2214022

GEO DataSets Gene

<< First< Prev

Page of 5

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 76641) (84)
GEO Profiles
PREDICTED: Vulpes lagopus beta-1,3-N-acetylgalactosaminyltransferase 1 (globosid...
PREDICTED: Vulpes lagopus beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) (B3GALNT1), transcript variant X26, mRNA
gi|2044139748|ref|XM_041731805.1|

Nucleotide
Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4...
Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932418O05 product:PKC MU PROTEIN (FRAGMENT) homolog [Rattus norvegicus], full insert sequence
gi|26081642|dbj|AK030058.1|

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 84

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity