GEO Profile Links for Gene (Select 320939) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 204

<< First< Prev

Page of 11

Next >Last >>

Select item 643483801.

5930403L14Rik - Hypertension model: aorta

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100102528_TGI_at (ID_REF), GDS3672, AK141913

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64348380

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 751069032.

5930403L14Rik - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS3987, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75106903

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 836126033.

5930403L14Rik - Transcription factor MIST1-null and MIST1-induced pancreas

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4341, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 83612603

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1189066034.

5930403L14Rik - Mmp-8 deficient ankle joint response to the induction of arthritis

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS5243, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118906603

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1087042035.

5930403L14Rik - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4973, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108704203

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1090513036.

5930403L14Rik - Phorbol ester effect on skin of Rho exchange factor Vav2/Vav3 double knockout mutants: time course

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4985, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 109051303

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 414165817.

5930403L14Rik - Nephronophthisis model

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL2897, 211061 (ID_REF), GDS2817, AK028466

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41416581

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1189433038.

5930403L14Rik - Ankle joint response to the induction of arthritis

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS5244, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118943303

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1000616039.

5930403L14Rik - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4588, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100061603

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7940110310.

5930403L14Rik - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4116, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79401103

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 749007411.

5930403L14Rik - MPSS transcriptome analysis project

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGTACTCTCTAGAGG (ID_REF), GDS868, AW489057

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7490074

GEO DataSets Gene Chromosome neighbors

Select item 8377210312.

5930403L14Rik - Pancreatic CD45+ immune cells from NOD model of type 1 diabetes

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4347, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 83772103

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 7936440313.

5930403L14Rik - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4115, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79364403

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8991360314.

5930403L14Rik - Sex effect on chronic coxsackievirus B3-induced myocarditis: heart

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4436, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 89913603

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11829330315.

5930403L14Rik - Adam10 deficiency effect on the epidermis

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS5229, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118293303

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10784980316.

5930403L14Rik - Estrogen effect on male and female haematopoietic stem cells

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4944, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107849803

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9683780317.

5930403L14Rik - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS4486, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96837803

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 4681607818.

5930403L14Rik - Dicer inactivation effect on the embryonic heart

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL5025, 18578 (ID_REF), GDS3033, AK028466

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46816078

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12568760319.

5930403L14Rik - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL6246, 10519046 (ID_REF), GDS5421, NR_045643, chr4:154635466-154635897 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125687603

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6446718020.

5930403L14Rik - Hypertension model: kidney

Annotation:: 5930403L14Rik, RIKEN cDNA 5930403L14 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100102528_TGI_at (ID_REF), GDS3675, AK141913

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64467180

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 11

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 320939) (204)
GEO Profiles
GEO Profile Links for Gene (Select 21956) (2983)
GEO Profiles
GEO Profile Links for Gene (Select 15171) (1441)
GEO Profiles
GEO Profile Links for Gene (Select 19782) (183)
GEO Profiles
GEO Profile Links for Gene (Select 58805) (1293)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 204

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity