GEO Profile Links for Gene (Select 320363) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 19

Select item 46454711.

D030045P18Rik - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m21207_at (ID_REF), GDS592, D030045P18 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4645471

GEO DataSets Gene Chromosome neighbors

Select item 644751682.

D030045P18Rik - Hypertension model: kidney

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100103186_TGI_at (ID_REF), GDS3675, AK080062

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64475168

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 414269243.

D030045P18Rik - Nephronophthisis model

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL2897, 303100 (ID_REF), GDS2817, BB219544

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41426924

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 643563684.

D030045P18Rik - Hypertension model: aorta

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100103186_TGI_at (ID_REF), GDS3672, AK080062

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64356368

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 625706625.

D030045P18Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl38948.8_11-S (ID_REF), GDS3621, D030045P18Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62570662

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 644355686.

D030045P18Rik - Hypertension model: liver

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100103186_TGI_at (ID_REF), GDS3674, AK080062

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64435568

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 187993247.

D030045P18Rik - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL2897, 303100 (ID_REF), GDS1729, BB219544

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18799324

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 756474288.

D030045P18Rik - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL6481, 104150059 (ID_REF), GDS4002, D030045P18Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75647428

GEO DataSets Gene Chromosome neighbors

Select item 978685689.

D030045P18Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100103186_TGI_at (ID_REF), GDS4527, AK080062

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97868568

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 767124110.

D030045P18Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATATTGTTCCTAAGTA (ID_REF), GDS878, AK080062

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7671241

GEO DataSets Gene Chromosome neighbors

Select item 3031197111.

D030045P18Rik - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m21207_at (ID_REF), GDS2327, D030045P18 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30311971

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6439596812.

D030045P18Rik - Hypertension model: heart

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100103186_TGI_at (ID_REF), GDS3673, AK080062

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64395968

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6197026213.

D030045P18Rik - Eset depletion effect on embryonic stem cell

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl38948.8_11-S (ID_REF), GDS3599, D030045P18Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61970262

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12782012814.

D030045P18Rik - Rhabdomyosarcoma model

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL6481, 104150059 (ID_REF), GDS5527, D030045P18Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127820128

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 753354115.

D030045P18Rik - MPSS transcriptome analysis project

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCATATTGTTCCTAAGTA (ID_REF), GDS868, AK080062

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533541

GEO DataSets Gene Chromosome neighbors

Select item 892972816.

D030045P18Rik - DNase II and type I interferon receptor double null mutation effect on fetal liver

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL1524, 6028 (ID_REF), GDS996, BB219544

DataSet type:: Expression profiling by array, count, 3 samples

ID:: 8929728

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9715556817.

D030045P18Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100103186_TGI_at (ID_REF), GDS4495, AK080062

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97155568

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 4682434418.

D030045P18Rik - Dicer inactivation effect on the embryonic heart

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL5025, 26844 (ID_REF), GDS3033, AK080062

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46824344

GEO DataSets Gene Chromosome neighbors

Select item 3957782819.

D030045P18Rik - Wilms' tumor protein Wt1 deficiency effect on the urogenital ridge

Annotation:: D030045P18Rik, RIKEN cDNA D030045P18 gene

Organism:: Mus musculus

Reporter:: GPL1524, 6028 (ID_REF), GDS2747, BB219544

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39577828

GEO DataSets Gene Chromosome neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

Conserved Domain Links for Protein (Select 73621233) (1)
Conserved Domains
GEO Profile Links for Gene (Select 320363) (19)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 19

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity