GEO Profile Links for Gene (Select 320286) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 17

Select item 303090161.

A630089K24Rik - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m18252_at (ID_REF), GDS2327, 4931430B21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30309016

GEO DataSets Gene Profile neighbors

Select item 414049902.

A630089K24Rik - Nephronophthisis model

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL2897, 108006 (ID_REF), GDS2817, AK042410

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41404990

GEO DataSets Gene Profile neighbors

Select item 625628673.

A630089K24Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl5690.1.1_119-S (ID_REF), GDS3621, A630089K24Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62562867

GEO DataSets Gene Profile neighbors

Select item 46425164.

A630089K24Rik - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m18252_at (ID_REF), GDS592, 4931430B21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4642516

GEO DataSets Gene

Select item 187773905.

A630089K24Rik - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL2897, 108006 (ID_REF), GDS1729, AK042410

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18777390

GEO DataSets Gene Profile neighbors

Select item 643446506.

A630089K24Rik - Hypertension model: aorta

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084700_TGI_at (ID_REF), GDS3672, AK042410

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64344650

GEO DataSets Gene Profile neighbors

Select item 619624677.

A630089K24Rik - Eset depletion effect on embryonic stem cell

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl5690.1.1_119-S (ID_REF), GDS3599, A630089K24Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61962467

GEO DataSets Gene Profile neighbors

Select item 619624668.

A630089K24Rik - Eset depletion effect on embryonic stem cell

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl37585.1.1719_24-S (ID_REF), GDS3599, A630089K24Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61962466

GEO DataSets Gene Profile neighbors

Select item 625628669.

A630089K24Rik - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL6333, scl37585.1.1719_24-S (ID_REF), GDS3621, A630089K24Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62562866

GEO DataSets Gene Profile neighbors

Select item 6438425010.

A630089K24Rik - Hypertension model: heart

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084700_TGI_at (ID_REF), GDS3673, AK042410

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64384250

GEO DataSets Gene Profile neighbors

Select item 4680702311.

A630089K24Rik - Dicer inactivation effect on the embryonic heart

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL5025, 9523 (ID_REF), GDS3033, AK042410

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46807023

GEO DataSets Gene Profile neighbors

Select item 748459212.

A630089K24Rik - MPSS transcriptome analysis project

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGCCTCTCTTTCCG (ID_REF), GDS868, AK042410

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7484592

GEO DataSets Gene

Select item 6442385013.

A630089K24Rik - Hypertension model: liver

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084700_TGI_at (ID_REF), GDS3674, AK042410

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64423850

GEO DataSets Gene Profile neighbors

Select item 9785685014.

A630089K24Rik - Atherosclerosis susceptibility model: macrophages

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084700_TGI_at (ID_REF), GDS4527, AK042410

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97856850

GEO DataSets Gene Profile neighbors

Select item 6446345015.

A630089K24Rik - Hypertension model: kidney

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084700_TGI_at (ID_REF), GDS3675, AK042410

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64463450

GEO DataSets Gene Profile neighbors

Select item 762229216.

A630089K24Rik - MPSS analysis of BLK CL.4 and liver cells

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGCCTCTCTTTCCG (ID_REF), GDS878, AK042410

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7622292

GEO DataSets Gene

Select item 9714385017.

A630089K24Rik - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: A630089K24Rik, RIKEN cDNA A630089K24 gene

Organism:: Mus musculus

Reporter:: GPL9734, 100084700_TGI_at (ID_REF), GDS4495, AK042410

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97143850

GEO DataSets Gene Profile neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 320286) (17)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 17

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity