GEO Profile Links for Gene (Select 228356) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 65331451.

1110051M20Rik - Smooth muscle cell differentiation induced by retinoic acid: time course

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL1307, 6211 (ID_REF), GDS799, BM206949, C0605G11-3 (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 23 samples

ID:: 6533145

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 954089072.

1110051M20Rik - Aged, lupus-prone MRL/Faslpr model: splenic CD4 T cells

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL1261, 1428501_at (ID_REF), GDS4190, 228356 (Gene ID), BQ176704

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 95408907

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 221158073.

1110051M20Rik - Inhibitor-1 knockout effect on the hippocampus

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL1261, 1428501_at (ID_REF), GDS1920, 228356 (Gene ID), BQ176704

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 22115807

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 66491994.

1110051M20Rik - Amyloid precursor protein mutant overexpression in strain resistant to neuronal cell loss

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS811, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 6649199

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 169964995.

1110051M20Rik - Nodose and dorsal root ganglia comparison (MG-U74A)

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS1634, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 16996499

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 285080996.

1110051M20Rik - Hippocampus of various inbred strains

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS2226, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 28508099

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 78200997.

1110051M20Rik - Synaptic acetylcholinesterase overexpression in prefrontal cortex

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS891, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 7820099

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 444676998.

1110051M20Rik - Neural retina leucine zipper deficiency effect on retinas: time course

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS2936, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 44467699

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 206605829.

1110051M20Rik - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL3222, M300012752 (ID_REF), GDS1826, BC032255

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20660582

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2105299910.

1110051M20Rik - Retinitis pigmentosa 1 gene knockout effect on retinas: time course

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS1845, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 21052999

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 97019911.

1110051M20Rik - Contextual fear conditioning paradigm

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS200, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 64 samples

ID:: 970199

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6590599912.

1110051M20Rik - Seizure model: brain

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS3536, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 28 samples

ID:: 65905999

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2504549913.

1110051M20Rik - Age effect on the hippocampus

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS2082, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 25045499

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7295636614.

1110051M20Rik - Inflammasome-compromised epidydimal white adipose response to a high fat diet

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL11180, 1439460_PM_a_at (ID_REF), GDS3925, BB317953

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 72956366

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 542049915.

1110051M20Rik - Down syndrome and brain (MG-U74A)

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS681, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 5420499

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749343316.

1110051M20Rik - MPSS transcriptome analysis project

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGCCACTAGCTGGAAT (ID_REF), GDS868, BC049648

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7493433

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 578119917.

1110051M20Rik - Huntingtons disease and combination drug therapy

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS717, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 5781199

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8206830718.

1110051M20Rik - Neocortical and cerebellar astrocytes

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL1261, 1428501_at (ID_REF), GDS3366, 228356 (Gene ID), BQ176704

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 82068307

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1450469919.

1110051M20Rik - Motoneuron characterization

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS1455, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 14504699

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1098549920.

1110051M20Rik - Telomere dysfunction effect on male germ cells

Annotation:: 1110051M20Rik, RIKEN cDNA 1110051M20 gene

Organism:: Mus musculus

Reporter:: GPL81, 94400_at (ID_REF), GDS1248, 228356 (Gene ID), AI843094

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 10985499

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 228356) (1000)
GEO Profiles
Legionella fairfieldensis macrophage infectivity potentiator (mip) gene, complet...
Legionella fairfieldensis macrophage infectivity potentiator (mip) gene, complete cds
gi|2231709|gb|U92204.1|LFU92204

Nucleotide

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity